Research ArticleSYNTHETIC BIOLOGY

Light-activated communication in synthetic tissues

See allHide authors and affiliations

Science Advances  01 Apr 2016:
Vol. 2, no. 4, e1600056
DOI: 10.1126/sciadv.1600056
  • Fig. 1 Construction and evaluation of a light-activated promoter.

    (A) T7 RNA polymerase is blocked from binding to the LA-T7 promoter due to the presence of multiple monovalent streptavidins, bound to the DNA through biotinylated PC linkers. Following UV light cleavage of the linkers, T7 RNA polymerase can transcribe the downstream gene. (B) LA-T7 promoter sequence. Pink-colored thymines are replaced with amino-C6-dT modifications and the primary amines of the nucleobase coupled to the PC biotin group. (C) LA-DNA encoding for mVenus is only expressed upon UV irradiation. There is no significant difference between expression from the LA-DNA (+UV) and expression from the amine-only DNA construct. a.u., arbitary unit.

  • Fig. 2 Light-activated expression of LA-mVenus in synthetic cells and synthetic tissues.

    (A) Schematic of a synthetic cell that will express mVenus protein upon light activation, where a single bilayer connects it to a neighboring synthetic cell. IVTT, in vitro transcription and translation. (B) Synthetic cells containing LA-mVenus DNA express mVenus protein (yellow) upon light activation. (C) Fluorescence intensity line profiles from (B). (D) Schematic of 3D-printed synthetic tissues containing hundreds of synthetic cells. A single lipid bilayer, as shown in (A), connects each cell with its neighbor. (E) Synthetic tissues containing LA-mVenus DNA express mVenus protein (yellow) upon light activation. (F) Fluorescence intensity line profiles from (E).

  • Fig. 3 Light-activated expression from LA–αHL-GFP DNA in a pair of synthetic cells forming a DIB.

    (A) Schematic of the synthetic cell pair. One cell contains LA–αHL–green fluorescent protein (GFP) DNA, the other contains no DNA. The αHL-GFP fusion pore protein will localize to the bilayer when expressed. (B) When LA–αHL-GFP DNA is activated in a synthetic cell neighboring another containing no DNA, the αHL-GFP fusion membrane pore protein locates to the bilayer. No expression is observed without light activation. (C) Fluorescence intensity line profiles from (B). (D) Rotated 3D projection of a z stack of αHL-GFP DNA, as expressed in (B), demonstrates that αHL-GFP becomes located throughout the flat interface bilayer.

  • Fig. 4 Light-activated electrical signal between synthetic cells.

    (A) Schematic of the synthetic cell pair. One cell contains LA-αHL DNA, the other contains no DNA. Both droplets have electrodes inserted within them to apply a potential and measure the ionic current. Below is an image of the experimental setup. (B) A current is detected only following the expression of αHL after light activation. (C) Voltage protocol used in (B).

  • Fig. 5 Recording of electrical communication in 3D-printed synthetic tissues mediated by LA-αHL DNA.

    (A) Schematic of 3D-printed synthetic tissue containing LA-αHL DNA, which expresses the αHL membrane pore upon light activation. (B) Electrical recordings from a 3D-printed network demonstrate that a current through the synthetic tissues is only detected upon light activation. The voltage protocol used to detect αHL insertion into bilayer is also shown.

  • Fig. 6 Light-activated patterned expression of mVenus from LA-mVenus DNA in a 3D-printed synthetic tissue.

    (A) Schematic showing a printed tissue with droplets containing LA-mVenus DNA (yellow) and droplets containing no DNA (gray). (B) After light activation, the mVenus-containing droplets become visible (yellow fluorescence).

  • Fig. 7 Electrical recordings from an L-shaped pathway formed by expression from LA-αHL DNA in a 3D-printed synthetic tissue.

    (A) Schematic of the printed tissue containing droplets with LA-αHL DNA (red) printed with droplets containing no DNA (clear region within black frame). Numbers represent sides of the cuboid where electrodes were placed to detect the conductive pathway. (B to F) Electrical recordings detect a current when the electrodes are at positions 1 and 2 (B), based on the voltage protocol in (B), but not when one or both of the electrodes are positioned off the pathway sides 1 and 3 (C), 1 and 4 (D), 1 and 5 (E), or 3 and 5 (F).

  • Table 1 DNA sequences.

    emGFP, emerald GFP; CT, control template.

    DNA nameDNA sequenceModification
    Amino T7GAATXAAXACGACXCACXAXAGGGXCXAGX = C6-amino-dT
    mV FRWTTAACTTTAAGAAGGAGGTATACATATGGTGAGCAAGGGCGAGGAGCTGT
    mV REVTACTCGAGAATTCCCGGGATCCTCATTACTTGTACAGCTCGTCCATGCCG
    CT-FP FRWCGGCATGGACGAGCTGTACAAGTAATGAGGATCCCGGGAATTCTCGAGTA
    CT-FP REVACAGCTCCTCGCCCTTGCTCACCATATGTATACCTCCTTCTTAAAGTTAAAC
    mC FRWTTAACTTTAAGAAGGAGGTATACATATGGTGAGCAAGGGCGAGGAGGATA
    mC REVTACTCGAGAATTCCCGGGATCCTCATTACTTGTACAGCTCGTCCATGCCG
    HL FRWTTAACTTTAAGAAGGAGGTATACATATGGCAGATTCTGATATTAATATTA
    HL-LINK REVAGAGCCACCTCCGCCTGAACCGCCACCACCCGAATTTGTCATTTCTTCTTTTTCCCAA
    HL REVTACTCGAGAATTCCCGGGATCCTCATTAATTTGTCATTTCTTCTTTTTCCCAA
    emGFP-LINK FRWTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGTGAGCAAGGGCGAGGAGCTGT
    CT-HL FRWTTGGGAAAAAGAAGAAATGACAAATTAATGAGGATCCCGGGAATTCTCGAGTA
    CT-HL REVTAATATTAATATCAGAATCTGCCATATGTATACCTCCTTCTTAAAGTTAAAC
    CT-emGFP FRWCGGCATGGACGAGCTGTACAAGTAATGAGGATCCCGGGAATTCTCGAGTA
    CT-seq FRWGCTAGTGGTGCTAGCCCCGC
    CT-seq REVGGGACCGCTAGCGCGGCCGC
    Fusion linkerTCGGGTGGTGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG
    CT REVGATATAGTTCCTCCTTTCAG

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/2/4/e1600056/DC1

    Fig. S1. Synthesis of LA-DNA from an amino T7 primer.

    Fig. S2. Binding of monovalent streptavidin and photocleavage of LA-DNA.

    Fig. S3. T7 RNA transcription from LA-DNA.

    Fig. S4. Light-activated expression from LA-mCherry DNA in synthetic cells.

    Fig. S5. Expression from amine-only mVenus DNA and LA-mVenus DNA in synthetic cells.

    Fig. S6. Light-activated transfer of a small-molecule fluorophore between synthetic cells.

    Fig. S7. Light-activated expression from LA-mCherry DNA in synthetic tissues.

    Fig. S8. Expression from amine-only mVenus DNA in synthetic tissues.

    Fig. S9. Tuning the packing of synthetic cells inside synthetic tissues by altering the bilayer size between synthetic cells.

    Fig. S10. Restricted microscope illumination of a synthetic tissue.

    Fig. S11. LA-mVenus protein expression in a light-patterned pathway.

    Fig. S12. Electrical recordings from an L-shaped 2D pathway formed by light patterning of an LA-αHL DNA 3D-printed synthetic tissue.

    Fig. S13. The three printing maps used to create the 3D printed pathway.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. Synthesis of LA-DNA from an amino T7 primer.
    • Fig. S2. Binding of monovalent streptavidin and photocleavage of LA-DNA.
    • Fig. S3. T7 RNA transcription from LA-DNA.
    • Fig. S4. Light-activated expression from LA-mCherry DNA in synthetic cells.
    • Fig. S5. Expression from amine-only mVenus DNA and LA-mVenus DNA in synthetic cells.
    • Fig. S6. Light-activated transfer of a small-molecule fluorophore between synthetic cells.
    • Fig. S7. Light-activated expression from LA-mCherry DNA in synthetic tissues.
    • Fig. S8. Expression from amine-only mVenus DNA in synthetic tissues.
    • Fig. S9. Tuning the packing of synthetic cells inside synthetic tissues by altering the bilayer size between synthetic cells.
    • Fig. S10. Restricted microscope illumination of a synthetic tissue.
    • Fig. S11. LA-mVenus protein expression in a light-patterned pathway.
    • Fig. S12. Electrical recordings from an L-shaped 2D pathway formed by light patterning of an LA-HL DNA 3D-printed synthetic tissue.
    • Fig. S13. The three printing maps used to create the 3D printed pathway.

    Download PDF

    Files in this Data Supplement: