Research ArticleBIOCHEMISTRY

Membrane localization of acetylated CNK1 mediates a positive feedback on RAF/ERK signaling

See allHide authors and affiliations

Science Advances  11 Aug 2017:
Vol. 3, no. 8, e1700475
DOI: 10.1126/sciadv.1700475

Figures

  • Fig. 1 Plasma membrane–anchored CNK1 activates ERK signaling.

    (A) Scheme of the multidomain protein CNK1. SAM, sterile alpha motif; CRIC, conserved region in CNK; PDZ, postsynaptic density protein/Drosophila disc large tumor suppressor/zonula occludens-1 protein; PH, pleckstrin homology; CC, coiled coil; CaaX, C-terminal membrane targeting motif of K-RAS; m/p, N-terminal membrane targeting site of LCK. (B) HeLa cells overexpressing HA (hemagglutinin)–CNK1–WT, HA-CNK1-CaaX, or m/p-HA-CNK1 were immunostained with anti-HA antibody detected by Alexa Fluor 594 rabbit anti-mouse immunoglobulin G (IgG) (red). DAPI (4′,6-diamidino-2-phenylindole) was used to visualize the nuclei (blue). Scale bars, 10 μm. (C)Cytoplasmic and membrane fractions of human embryonic kidney (HEK) 293 cells expressing HA-CNK1-WT, HA-CNK1-CaaX, or m/p-HA-CNK1 were immunoblotted with the antibodies indicated. αHA, anti-HA; αCRAF, anti-CRAF; αGAPDH, anti–glyceraldehyde-3-phosphate dehydrogenase; αPDGFR, anti–platelet-derived growth factor receptor; DL, direct lysates. (D) Lysates of HEK293 cells expressing HA-CNK1-WT, HA-CNK1-CaaX, or m/p-HA-CNK1 were immunoprecipitated with anti-HA (IP αHA) and immunoblotted with anti-HA for HA-tagged CNK1 proteins and with anti-CRAF for coprecipitating CRAF. Direct lysates were immunoblotted as indicated.

  • Fig. 2 Acetylation of CNK1 at Lys414 in its PH domain regulates membrane localization.

    (A) Amino acid sequence alignment of PH domains of selected CNK proteins and AKT1 performed by clustal analysis (45). Sequences according to their UniProt entry are as follows: human AKT1 (P31749), human CNK1 (Q969H4), mouse CNK1 (Q14CE3), rat CNK1 (Q499SO), human CNK2 (Q8WXI2), Drosophila melanogaster CNK (Q7KNQ9), and Caenorhabditis elegans CNK (G5EEW9). (B) Fluorescence images of GFP-CNK1 expressed in HeLa cells treated for 2 hours with nicotinamide (100 μM) or dimethyl sulfoxide (DMSO) for control. DAPI staining was used for visualizing nuclei (blue). Scale bars, 10 μm. (C) Acetylation state of HA-CNK1-WT or HA-CNK1-K414R expressed in HEK293 cells was monitored by anti-HA immunoprecipitation (IP αHA), followed by immunoblotting with anti–acetyl-Lys (αAc-Lys). Bar chart represents quantification of immunoblot signals of three independent experiments. ±SD, two-tailed Student’s t test, ***P < 0.001. (D and E) Lysates of HEK293 cells coexpressing HA-CNK1 and FLAG-SIRT1 (D) and FLAG-SIRT2 (E) were immunoprecipitated with anti-HA and subsequently immunoblotted with anti-HA or anti-FLAG. (F) HEK293 cells expressing HA-CNK1-WT were treated with the Sirt2 inhibitor AGK2. Anti-HA immune complexes were immunoblotted with anti–Ac-Lys to detect acetylated CNK1. Bar chart represents quantification of immunoblot signal of three independent experiments. ±SD, two-tailed Student’s t test, ***P < 0.001.

  • Fig. 3 Growth factor–induced acetylation of CNK1 depends on ERK signaling.

    (A) HEK293 cells expressing HA-CNK1-WT were stimulated with EGF (20 ng/ml) or IGF (20 ng/ml). Anti-HA immunocomplexes (IP αHA) were immunoblotted with anti–Ac-Lys to detect acetylated HA-CNK1. Bar chart represents quantification of Western blot signal of three independent experiments. ±SD, quantification shows fold increased signal to untreated control. (B) HEK293 cells expressing HA-CNK1-WT or HA-CNK1-K414R were stimulated for 30 min with EGF (20 ng/ml) or IGF (20 ng/ml), and anti-HA immunocomplexes were immunoblotted with anti–Ac-Lys. Bar chart represents quantification of Western blot signal of three independent experiments. ±SD, quantification shows fold increased signal to untreated control. (C) Lysates of HEK293 cells coexpressing HA-CNK1-WT and HA-CBP were immunoprecipitated with anti-CNK1 antibody (IP αCNK1) and immunoblotted with anti-HA to monitor HA-CBP. Direct lysates (DL) were shown for control. (D) HEK293 cells expressing HA-CNK1-WT were pretreated with the CBP inhibitor C646 for 2 hours (5 μM) before being incubated for 30 min with EGF (20 ng/ml). Anti-HA immunocomplexes were immunoblotted with anti–Ac-Lys. Bar chart represents quantification of Western blot signal of three independent experiments. ± SD, two-tailed Student’s t test, ***P < 0.001. Direct lysates were immunoblotted with the antibodies indicated. (E) HEK293 cells expressing HA-CNK1-WT were pretreated with U0126 (10 μM) for 2 hours before being incubated for 30 min with EGF (20 ng/ml). Anti-HA immunocomplexes were immunoblotted with anti–Ac-Lys to detect acetylated HA-CNK1. Bar chart represents quantification of Western blot signal of three independent experiments. Direct lysates were immunoblotted with the antibodies indicated. ±SD, two-tailed Student’s t test, ***P < 0.001.

  • Fig. 4 Constitutive membrane-bound CNK1 and the acetylation mimetic mutant CNK1-K414Q activate ERK.

    (A) Immunostaining of HA-CNK1-K414Q and HA-CNK1-K414R expressed in HeLa cells was performed with anti-HA antibody detected by Alexa Fluor 594 rabbit anti-mouse IgG (red). DAPI was used for visualizing nuclei (blue). Scale bars, 10 μm. (B) HEK293 cells were transfected with the HA-CNK1 constructs indicated. Anti-HA immunocomplexes were immunoblotted with anti-CRAF. Direct lysates (DL) were analyzed for active ERK by anti–phosphorylated ERK (pERK) immunoblotting.

  • Fig. 5 Oncogenic potential of CNK1 mutated in Arg426 that is located in the PH domain.

    (A) Acetylation state of HA-CNK1-WT and the indicated CNK1 mutants expressed in HEK293 cells was monitored by anti-HA immunoprecipitation (IP αHA) followed by immunoblotting with anti–Ac-Lys. (B) Cytoplasmic and membrane fractions of HEK293 cells expressing CNK1-WT or the CNK1 mutants indicated were immunoblotted HEK293 with anti-HA and anti-CRAF. PDGFR and GAPDH were monitored as markers for the plasma membrane and the cytoplasmic fraction, respectively. (C) CNK1-WT and the CNK1 mutants indicated were expressed in HEK293 cells. Anti-HA immunocomplexes were immunoblotted with anti-CRAF to detect CRAF coprecipitating with HA-CNK1 proteins. (D) HEK293 cells overexpressing the indicated HA-CNK1 constructs were treated for 48 hours with the AKT inhibitor MK2206 (10 μM), the MEK inhibitor U0126 (10 μM), or DMSO for control. Cell proliferation was analyzed by an MTT assay. ±SD, two-tailed Student’s t test, ***P < 0.001. (E) HEK293 cells expressing HA-CNK1-WT, HA-CNK1-R426S, HA-CNK1-CaaX, HA-CNK1-K414Q, and HA-CNK1-K414R were transferred into wells of a Boyden chamber and incubated for 48 hours with the AKT inhibitor MK2206 (10 μM), the MEK inhibitor U0126 (10 μM), or DMSO for control. Cells migrated through the porous membrane were monitored by staining with Giemsa solution. Right: Images for the selected samples. Bar chart shows quantification of three independent experiments. Scale bars, 100 μm. ±SD, two-tailed Student’s t test, ***P < 0.001.

  • Fig. 6 CNK1 mediates RAS-driven oncogenic signaling.

    (A) The acetylation state of CNK1 was studied in Sbcl-2 melanoma cells expressing oncogenic NRAS (NRASQ61K). Cells were pretreated for 2 hours with C646 (5 μm) and analyzed by anti-CNK1 immunoprecipitation (IP αCNK1) followed by immunoblotting (IB) with anti–Ac-Lys, anti-CRAF, or anti-CNK1. (B) Sbcl-2 cells transfected with CNK1-specific small interfering RNA (siRNA) (siCNKa) or control siRNA (siControl) for 48 hours or treated with C646 (5 μM) or DMSO for 2 hours were subjected to subcellular fractionation. Cytoplasmic (CP) and membrane (M) fractions were immunoblotted with anti-CNK1 anti-CRAF. Detection of PDGFR and GAPDH was used as membrane and cytoplasmic markers, respectively. (C) Sbcl-2 cells were treated for 48 hours either with CNK1-specific siRNA (siCNKa or siCNKb) or control siRNA (siControl) or with the acetylase inhibitor C646, the farnesyltransferase inhibitor salisarib, or DMSO. Cell proliferation was analyzed by an MTT assay. ±SD, two-tailed Student’s t test, ***P < 0.001. (D) Scheme showing the effect of acetylation on CNK1 signaling. Mutants in CNK1-R426 found in human tumors are bound to the plasma membrane and constitutively stimulate RAF/MEK/ERK signaling. GF, growth factor.

Tables

  • Table 1 Primers designed and used in this work.

    PCR, polymerase chain reaction.

    NameSequence
    Primers for site-directed mutagenisis
    O PM K414Q 1 fwCGTGTTGCGACAGGCACCGG
    O PM K414Q 1 rvCCGGTGCCTGTCGCAACAGG
    O PM K414R 1 fwCCTGTTGCGAAGGGCACCGG
    O PM K414R 1 fwCCGGTGCCCTTCGCAACAGG
    O PM R426C 1 fwCTGGCGCTGCCGCTGG
    O PM R426C 1 rvCCAGCGGCAGCGCCAG
    O PM R426C 1 fwCTGGCGCTGCCGCTGG
    O PM R426C 1 rvCCAGCGGCAGCGCCAG
    O PM R426S 1 fwCTGGCGCAGCCGCTGG
    O PM R426S 1 rvCCAGCGGCTGCGCCAG
    Primers for PCR-based cloning
    NameSequence
    bbl fwCTGCCGCTTACCGGATAC
    bbl rvCCACTGAGCGTCAGACC
    O AF 7GGCTGTGGCTGCAGCTCACACC
    CGGAATACCCCTACGACGTTGCC
    O AF 8TTCCGGGTGTGAGCTGCAGCCA
    CAGCCGGCCATGGCAGCTTGG