Research ArticleGENETICS

Correction of diverse muscular dystrophy mutations in human engineered heart muscle by single-site genome editing

See allHide authors and affiliations

Science Advances  31 Jan 2018:
Vol. 4, no. 1, eaap9004
DOI: 10.1126/sciadv.aap9004
  • Fig. 1 Myoediting strategy and identification of optimal guide RNAs to target the top 12 exons in DMD.

    (A) Conserved splice sites contain multiple NAG and NGG sequences, which enable cleavage by SpCas9. The numbers indicate the frequency of occurrence (%). (B) Human DMD exon structure. Shapes of intron-exon junctions indicate complementarity that maintains the open reading frame upon splicing. Red arrowheads indicate the top 12 targeted exons. The numbers indicate the order of the exons. (C) T7E1 assays in human 293 cells transfected with plasmids expressing the corresponding guide RNA (gRNA), SpCas9, and GFP for the top 12 exons. The PCR products from GFP+ and GFP cells were cut with T7 endonuclease I (T7E1), which is specific to heteroduplex DNA caused by CRISPR/Cas9-mediated genome editing. Red arrowhead indicates cleavage bands of T7E1. bp indicates the base pair length of the marker bands.

  • Fig. 2 Rescue of dystrophin mRNA expression in iPSC-derived cardiomyocytes with diverse mutations by myoediting.

    (A) Schematic of the myoediting of DMD iPSCs and 3D-EHMs–based functional assay. (B) Myoediting targets the exon 51 splice acceptor site in Del DMD iPSCs. A deletion (exons 48 to 50) in a DMD patient creates a frameshift mutation in exon 51. The red box indicates out-of-frame exon 51 with a stop codon. Destruction of the exon 51 splice acceptor in DMD iPSCs allows splicing from exons 47 to 52 and restoration of the dystrophin open reading frame. (C) Using the guide RNA library, three guide RNAs (Ex51-g1, Ex51-g2, and Ex51-g3) that target sequences 5′ of exon 51 were selected. (D) RT-PCR of cardiomyocytes differentiated from uncorrected DMD (Del), corrected DMD (Del-Cor.), and WT iPSCs. Skipping of exon 51 allows splicing from exons 47 to 52 (lower band) and restoration of the DMD open reading frame. (E) Myoediting strategy for pseudo-exon 47A (pEx). DMD exons are represented as blue boxes. Pseudo-exon 47A (red) with stop codon is marked by a stop sign. The black box indicates myoediting-mediated indel. (F) Sequence of guide RNAs for pseudo-exon 47A of pEx. DMD exons are represented as blue boxes, and pseudo-exons are represented as red boxes (47A). sgRNA, single-guide RNA. (G) RT-PCR of human cardiomyocytes differentiated from WT, uncorrected DMD (pEx), and corrected DMD iPSCs (pEx-Cor.) by guide RNAs In47A-g1 and In47A-g2. Skipping of pseudo-exon 47A allows splicing from exons 47 to 48 (lower band) and restoration of the DMD open reading frame. (H) Myoediting strategy for the duplication (Dup) of exons 55 to 59. DMD exons are represented as blue boxes. Duplicated exons are represented as red boxes. The black box indicates myoediting-mediated indel. (I) Sequence of guide RNAs for intron 54 of Dup (In54-g1, In54-g2, and In54-g3). (J) RT-PCR of human cardiomyocytes differentiated from WT, uncorrected DMD (Dup), and corrected DMD iPSCs (Dup-Cor.). Skipping of duplicated exons 55 to 59 allows splicing from exons 54 to 55 and restoration of the DMD open reading frame. RT-PCR of RNA was performed with the indicated sets of primers (F and R) (table S2).

  • Fig. 3 Immunocytochemistry and Western blot analysis show dystrophin protein expression rescued by myoediting.

    (A to C) Immunocytochemistry of dystrophin expression (green) shows DMD iPSC cardiomyocytes lacking dystrophin expression. Following successful myoediting, the corrected DMD iPSC cardiomyocytes express dystrophin. Immunofluorescence (red) detects cardiac marker troponin-I. Nuclei are labeled by Hoechst dye (blue). (D to F) Western blot analysis of WT (100 and 50%), uncorrected (Del, pEx, and Dup) and corrected DMD (Del-Cor#27, pEx-Cor#19, and Dup-Cor#6.) iCM. Red arrowhead (above 250 kD) indicates the immunoreactive bands of dystrophin. Blue arrowhead (above 150 kD) indicates the immunoreactive bands of MyHC loading controls. kD indicates protein molecular weight. Scale bar, 100 μm. Uncropped Western blots with Del-Cor., pEx-Cor., Dup-Cor., and other single colonies are presented in fig. S5.

  • Fig. 4 Rescued DMD cardiomyocyte-derived EHM showed enhanced FOC.

    (A) Experimental setup for EHM preparation, culture, and analysis of contractile function. (B to D) Contractile dysfunction in DMD EHM can be rescued by myoediting. FOC normalized to muscle content of each individual EHM in response to increasing extracellular calcium concentrations; n = 8/8/6/4/6/6/4/4; *P < 0.05 by two-way analysis of variance (ANOVA) and Tukey’s multiple comparison test. WT EHM data are pooled from parallel experiments with indicated DMD lines and applied to Fig. 4 (B to D). (E) Maximal cardiomyocyte FOC (at 4 mM extracellular calcium) normalized to WT. n = 8/8/6/4/6/6/4/4; *P < 0.05 by one-way ANOVA and Tukey’s multiple comparison test. (F) Titration of corrected cardiomyocytes revealed that 30% of cardiomyocytes needed to be repaired to partially rescue the phenotype, and 50% of cardiomyocytes needed to be repaired to fully rescue the phenotype (100% Del-Cor.) in EHMs. WT, Del, and 100% Del-Cor. are pooled data, as displayed in Fig. 4B.

  • Table 1 Guide RNA sequences of top 12 exons.
    ExonApplicability (30)gRNA/PAM at acceptor sitegRNA/PAM at donor site
    5113.0%#1: TGCAAAAACCCAAAATATTTTAG
    #2: AAAATATTTTAGCTCCTACTCAG
    #3: CAGAGTAACAGTCTGAGTAGGAG*
    458.1%#1: TTGCCTTTTTGGTATCTTACAGG
    #2: TTTGCCTTTTTGGTATCTTACAG
    #3: CGCTGCCCAATGCCATCCTGGAG
    537.7%#1: ATTTATTTTTCCTTTTATTCTAG#4: AAAGAAAATCACAGAAACCAAGG
    #2: TTTCCTTTTATTCTAGTTGAAAG#5: AAAATCACAGAAACCAAGGTTAG
    #3: TGATTCTGAATTCTTTCAACTAG#6: GGTATCTTTGATACTAACCTTGG
    446.2%#1: ATCCATATGCTTTTACCTGCAGG#4: GTAATACAAATGGTATCTTAAGG
    #2: GATCCATATGCTTTTACCTGCAG
    #3: CAGATCTGTCAAATCGCCTGCAG
    464.3%#1: TTATTCTTCTTTCTCCAGGCTAG
    #2: AATTTTATTCTTCTTTCTCCAGG
    #3: CAATTTTATTCTTCTTTCTCCAG
    524.1%#1: TAAGGGATATTTGTTCTTACAGG
    #2: CTAAGGGATATTTGTTCTTACAG
    #3: TGTTCTTACAGGCAACAATGCAG
    504.0%#1: TGTATGCTTTTCTGTTAAAGAGG
    #2: ATGTGTATGCTTTTCTGTTAAAG
    #3: GTGTATGCTTTTCTGTTAAAGAG
    433.8%#1: GTTTTAAAATTTTTATATTACAG#4: TATGTGTTACCTACCCTTGTCGG
    #2: TTTTATATTACAGAATATAAAAG#5: AAATGTACAAGGACCGACAAGGG
    #3: ATATTACAGAATATAAAAGATAG#6: GTACAAGGACCGACAAGGGTAGG
    63.0%†#1: TGAAAATTTATTTCCACATGTAG#4: ATGCTCTCATCCATAGTCATAGG
    #2: GAAAATTTATTTCCACATGTAGG#5: TCTCATCCATAGTCATAGGTAAG
    #3: TTACATTTTTGACCTACATGTGG#6: CATCCATAGTCATAGGTAAGAAG
    73.0%†#1: TGTGTATGTGTATGTGTTTTAGG
    #2: TATGTGTATGTGTTTTAGGCCAG
    #3: CTATTCCAGTCAAATAGGTCTGG
    82.3%#1: GTGTAGTGTTAATGTGCTTACAG#4: TGCACTATTCTCAACAGGTAAAG
    #2: GGACTTCTTATCTGGATAGGTGG#5: TCAAATGCACTATTCTCAACAGG
    #3: TAGGTGGTATCAACATCTGTAAG#6: CTTTACACACTTTACCTGTTGAG
    552.0%#1: TGAACATTTGGTCCTTTGCAGGG
    #2: TCTGAACATTTGGTCCTTTGCAG
    #3: TCTCGCTCACTCACCCTGCAAAG

    *Bold sequence indicates the best guide RNAs for myoediting.

    †Dual exon skipping (exons 6 and 7).

    Supplementary Materials

    • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/4/1/eaap9004/DC1

      fig. S1. Genome editing of DMD top 12 exons by CRISPR/Cas9.

      fig. S2. Correction of a large deletion mutation (Del. Ex47 to Ex50) in DMD iPSCs and iPSC-derived cardiomyocytes.

      fig. S3. Correction of a pseudo-exon mutation (pEx47A) in DMD iPSCs and iPSC-derived cardiomyocytes.

      fig. S4. Correction of a large duplication mutation (Dup. Ex55 to Ex59) in DMD iPSCs and iPSC-derived cardiomyocytes.

      fig S5. Dystrophin protein expression rescued by myoediting.

      fig S6. Cardiomyocyte content and structure in myoedited EHM.

      table S1. Sequence of primers for top 12 exons.

      table S2. Sequence of primers for DMD iPSCs.

      table S3. DNA sequence of corrected iPSC single clones.

      movie S1. WT iPSC–derived 3D-EHM on flexible holders.

      movie S2. Uncorrected Del iPSC–derived 3D-EHM on flexible holders.

      movie S3. Del-Cor-SC iPSC–derived 3D-EHM on flexible holders.

      movie S4. Uncorrected pEx iPSC–derived 3D-EHM on flexible holders.

      movie S5. pEx-Cor. iPSC–derived 3D-EHM on flexible holders.

      movie S6. pEx-Cor-SC iPSC–derived 3D-EHM on flexible holders.

      movie S7. Uncorrected Dup iPSC–derived 3D-EHM on flexible holders.

      movie S8. Dup-Cor-SC iPSC–derived 3D-EHM on flexible holders.

    • Supplementary Materials

      This PDF file includes:

      • fig. S1. Genome editing of DMD top 12 exons by CRISPR/Cas9.
      • fig. S2. Correction of a large deletion mutation (Del. Ex47 to Ex50) in DMD iPSCs and iPSC-derived cardiomyocytes.
      • fig. S3. Correction of a pseudo-exon mutation (pEx47A) in DMD iPSCs and iPSC-derived cardiomyocytes.
      • fig. S4. Correction of a large duplication mutation (Dup. Ex55 to Ex59) in DMD iPSCs and iPSC-derived cardiomyocytes.
      • fig S5. Dystrophin protein expression rescued by myoediting.
      • fig S6. Cardiomyocyte content and structure in myoedited EHM.
      • table S1. Sequence of primers for top 12 exons.
      • table S2. Sequence of primers for DMD iPSCs.
      • table S3. DNA sequence of corrected iPSC single clones.

      Download PDF

      Other Supplementary Material for this manuscript includes the following:

      • movie S1 (.mp4 format). WT iPSC–derived 3D-EHM on flexible holders.
      • movie S2 (.mp4 format). Uncorrected Del iPSC–derived 3D-EHM on flexible holders.
      • movie S3 (.mp4 format). Del-Cor-SC iPSC–derived 3D-EHM on flexible holders.
      • movie S4 (.mp4 format). Uncorrected pEx iPSC–derived 3D-EHM on flexible holders.
      • movie S5 (.mp4 format). pEx-Cor. iPSC–derived 3D-EHM on flexible holders.
      • movie S6 (.mp4 format). pEx-Cor-SC iPSC–derived 3D-EHM on flexible holders.
      • movie S7 (.mp4 format). Uncorrected Dup iPSC–derived 3D-EHM on flexible holders.
      • movie S8 (.mp4 format). Dup-Cor-SC iPSC–derived 3D-EHM on flexible holders.

      Files in this Data Supplement:

    Navigate This Article