Research ArticleChemistry

Encoding canonical DNA quadruplex structure

See allHide authors and affiliations

Science Advances  31 Aug 2018:
Vol. 4, no. 8, eaat3007
DOI: 10.1126/sciadv.aat3007
  • Fig. 1 Structural descriptors of canonical quadruplexes.

    (A) The 2(+lnd−p) folding topology and hydrogen bond alignments for its top tetrad are shown. Magenta denotes syn glycosidic bond angles, and cyan denotes anti. The gray circle indicates the 5′ end of the stem. Strand directionalities are indicated by (−) when counter-clockwise and by (+) when clockwise. Propeller loops are indicated by the symbol “p,” diagonal loops by “d,” and lateral loops by “l.” (B) Schematic representations of named high-resolution solution structures publicly available in the Protein Data Bank (PDB) (42) are shown, with corresponding PDB ID and the respective schematic of the quadruplex topology. The topology of the two-stacked thrombin binding aptamer “TBA” (PDB ID: 148D) is known as a chair-type quadruplex. It can be described as a quadruplex adopting the 2(+ln+lw+ln) topology. The two two-stacked basket-type architectures of human telomeric repeats (2KF8) and Giardia telomeric repeats (2KOW) are denoted 2(−lwd+ln) and 2(+lnd−lw), respectively. The three-stacked form-1 and form-2 topologies of human telomeric sequences are described by 3(−p−ln−lw) for (2GKU) and 3(−lw−ln−p) for (2JPZ), respectively. Finally, the (3+1) scaffold of 2LOD can be named 3(−pd+ln).

  • Fig. 2 Experimental verification of propeller loops bridging parallel stranded synG-synG-antiG grooves.

    (A) Schematic representations of grooves composed of parallel-stranded synG-antiG-antiG (left) and synG-synG-antiG (right) segments. The 2′-deoxyguanosines are shown as syn (magenta) and anti (cyan) conformations. (B) The design of the 3(d+pd) topology using the DNA sequence d(G3T4G3TG3T4G3), where a single thymine was used to form a propeller loop and four-thymine segments to form diagonal loops. (C) Expansion of the proton NMR spectrum at 5°C illustrates the 12 assigned imino protons, indicating formation of a three-stacked quadruplex fold in 16 mM NaCl and 4 mM NaH2PO4/Na2HPO4 (pH 6.8). (D) Family of 10 superpositioned refined structures of the quadruplex formed by this sequence in solution. (E) View into the medium grove populated by the single thymine of the propeller clockwise loop. (F) Bird’s eye view of the disposition of the second diagonal loop capping the stem over the (G1:G14:G10:G19) tetrad. (G) Bird’s eye view of the disposition of the first diagonal loop over the (G3:G12:G8:G21) tetrad. ppm, parts per million.

  • Fig. 3 Alternative conformations of glycosyl bonds in a quadruplex stem are possible.

    (A) Schematic representations of the alternative sequence of glycosidic bond angles in the 3(−lwd+ln) topology for PDB ID 143D (left) and the designed 5J05, as well as corresponding groove-width combinations (B) in the stem. (C) A bundle of solution structures adopted by the DNA sequence 5J05 in 100 mM sodium solution at pH 6.8. (D) The capping of the diagonal onto the (G1:G9:G20:G14) tetrad, with the arrow indicating the position of synG1. (E) Detail of the intrastrand stacking of the interdigitated adenine stacking onto antiG18 of the stem and T6. (F) Design of the 3(−lwd+ln) topology by replacing the nucleoside dG7 of the DNA sequence S232 by an rG in S209, as shown in red in the schematics for the topology. In the expansion of the proton NMR spectrum in 0.1 M sodium solutions at 5°C shown, the imino protons in the spectrum of S232 appear predominantly as “hump” at approximately 10.8 ppm, indicating that the sequence is mostly unfolded. Nineteen of 21 possible imino protons in the DNA sequence appear in the spectrum of S209, indicating formation of a three-stacked quadruplex fold. The topology has been structurally characterized (Supplementary Materials).

  • Fig. 4 Structural details for high-resolution structures designed to adopt the (−lwd+ln) topology.

    The DNA sequences 5J6U and 2M6W adopt 4(−lwd+ln), and 2M6V, 5J4W, and 5J4P adopt 2(−lwd+ln) in 100 mM sodium solution at pH 6.8. For each structure, details of loop stacking interactions with the top (left most) and bottom (right) tetrads are depicted. The red arrows indicate proximity of the 5′-synG residue of the stem to the third thymine in the diagonal loop. 2′-Deoxyguanosines of the stem in syn (magenta) and anti (cyan) conformations, non-stem guanosines (green), and thymines (yellow) are also shown. In all structures, the first thymine of the diagonal loop stacks onto the preceding guanosine of the stem.

  • Fig. 5 Schematic description of all canonical quadruplex topologies feasible with their constituent groove type combination.

    (Top) syn (magenta) and anti (cyan) guanosines combined through hydrogen bond alignments to form tetrads representing the eight possible quadruplex stems. Indicated in gray are the only possible strand progression directionalities for each stem.

  • Table 1 Oligonucleotide sequences designed to study folding of the (−lwd+ln) topology.

    Guanosines in syn conformation appear in bold when determined. PRE, pre-stem residues; POS, post-stem residues; Ms, multiple species; Str, high-resolution structure determined; Top, characterization of (−lwd+ln) topology by solution NMR methods.

    NamePREG1L1G2L2G3L3G4POSStatus
    S036GGGGTTGGGGTTTTGGGGTGGGGTop
    S141GGGGTTGGGGTTTTGGGGTTGGGGMs
    2M6WGGGGTTGGGGTTTTGGGGAAGGGGStr
    S069GGGGTTGGGGTTTTGGGGTTTGGGGTop
    S067GGGGAAGGGGTTTTGGGGTTTGGGGTop
    S064GGGGTTTGGGGTTTTGGGGAGGGGMs
    5J6UGGGGTTTGGGGTTTTGGGGAAGGGGStr
    S080GGGGTTTGGGGTTTTGGGGTTTGGGGTop
    S066GGGGTTTTGGGGTTTTGGGGAAGGGGMs
    201DGGGGTTTTGGGGTTTTGGGGTTTTGGGG(43)
    230DGGGGTUTUGGGGTTTTGGGGUUTTGGGI(23)
    S025GGGTTGGGTTTTGGGAGGGMs
    S087GGGTTGGGTTTTGGGAAGGGMs
    S089GGGTTGGGTTTTGGGTTTGGGTop
    S088GGGAAGGGTTTTGGGTTTGGGTop
    5J05GGGTTTGGGTTTTGGGAGGGStr
    S029GGGTTTGGGTTTTGGGTGGGMs
    S093TGGGTTTGGGTTTTGGGAGGGTop
    S090GGGTTTGGGTTTTGGGAAGGGTop
    S232GGGTTTGGGTTTTGGGTTGGGMs
    S209GGGTTT(rG)GGTTTTGGGTTGGGTop
    S210GGGTTTGGGTTTT(rG)GGTTGGGMs
    S231GGGTTTGGGTTTTGGGTTTGGGTop
    S174GGGTTTTGGGTTTTGGGTTGGGMs
    S175GGGTTTTGGGTTTTGGGTTTGGGMs
    S038aGGGTTTTGGGTTTTGGGTTTTGGGMs
    S166GGTTGGTTTTGGTGGMs
    S169GGTTGGTTTTGGTTGG*
    S230AGGTTGGTTTTGGTTGGMs
    S172GGTTGGTTTTGGTTTGGTop
    S167GGTTTGGTTTTGGTGGTop
    5J4WGGTTTGGTTTTGGTTGGStr
    S205AGGTTTGGTTTTGGTTGGMs
    5J4PGGTTTGGTTTTGGTTTGGStr
    S168GGTTTTGGTTTTGGTGGMs
    S171GGTTTTGGTTTTGGTTGGTop
    2M6VGGGTTGGGTTTTGGGTGGGStr
    2KF8GGGTTAGGGTTAGGGTTAGGGT(24)
    2KKAAGGGTTAGGGTTAIGGTTAGGGT(44)

    *Not (−lwd+ln). Except for 2KF8 (90 mM K+ solution pH 7) and 2KKA (95 mM K+ solution pH 7), folding was evaluated in 100 mM Na+ solution pH 6.7.

    Supplementary Materials

    • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/4/8/eaat3007/DC1

      Assessment of folding of DNA sequences

      Characterization of structure

      Identification of topology

      NMR chemical shifts tables

      Structural statistics tables

      Fig. S1. Expansions of 1D NMR spectra of imino proton regions for DNA sequences folding into quadruplexes in this study.

      Fig. S2. NMR structure characterization of 2MFT.

      Fig. S3. NMR structure characterization of aromatic and anomeric regions of 2MW6.

      Fig. S4. NMR structure characterization of inosine substitutions for 2MW6.

      Fig. S5. Intraresidue aromatic-imino assignments for guanines in the stem of 2MW6.

      Fig. S6. Exchangeable proton assignments for the structure of 2M6W.

      Fig. S7. Nonexchangeable 1H and 31P assignments for 5J6U.

      Fig. S8. Exchangeable proton assignments for 5J6U.

      Fig. S9. Nonexchangeable 1H assignments for 5J05.

      Fig. S10. Exchangeable proton assignments for 5J05.

      Fig. S11. Sequence-specific assignments for 5J4W.

      Fig. S12. Exchangeable proton assignments for 5J4W.

      Fig. S13. Nonexchangeable 1H assignments for 5J4P.

      Fig. S14. Exchangeable proton assignments for 5J4P.

      Fig. S15. Nonexchangeable 1H and 31P assignments for 2M6V.

      Fig. S16. Exchangeable proton perturbations for the inosine substitutions on 2M6V.

      Fig. S17. Exchangeable proton assignments for 2M6V.

      Fig. S18. NMR experiments for characterization of the 4(−lwd+ln) topology formed by the DNA sequences S069, S067, S036, and S080.

      Fig. S19. Solution NMR experiments for characterization of the 3(−lwd+ln) topology formed by the DNA sequences S231, S090, S089, S088, and S093.

      Fig. S20. Solution NMR experiments for characterization of the 2(−lwd+ln) topology formed by the DNA sequences S167, S171, and S172.

      Fig. S21. Use of riboguanosines to induce folding of the 3(−lwd+ln) topology.

      Fig. S22. Exchangeable proton assignments for 3(−lwd+ln) topology formed by S090.

      Table S1. Proton chemical shifts for the structure of 2MFT.

      Table S2. Proton and phosphorous chemical shifts for structure of 2M6W.

      Table S3. Proton and phosphorous chemical shifts for structure of 5J6U.

      Table S4. Proton chemical shifts for the structure of 5J05.

      Table S5. Proton chemical shifts for the structure of 5J4W.

      Table S6. Proton chemical shifts for the structure of 5J4P.

      Table S7. Proton and phosphorous chemical shifts for the structure of 2M6V.

      Table S8. NMR restraints and structural statistics for the structures of 2MFT.

      Table S9. NMR restraints and structural statistics for the structures of 2M6W.

      Table S10. NMR restraints and structural statistics for the structures of 5J6U.

      Table S11. NMR restraints and structural statistics for the structures of 5J05.

      Table S12. NMR restraints and structural statistics for the structures of 5J4W.

      Table S13. NMR restraints and structural statistics for the structures of 5J4P.

      Table S14. NMR restraints and structural statistics for the structures of 2M6V.

    • Supplementary Materials

      This PDF file includes:

      • Assessment of folding of DNA sequences
      • Characterization of structure
      • Identification of topology
      • NMR chemical shifts tables
      • Structural statistics tables
      • Fig. S1. Expansions of 1D NMR spectra of imino proton regions for DNA sequences folding into quadruplexes in this study.
      • Fig. S2. NMR structure characterization of 2MFT.
      • Fig. S3. NMR structure characterization of aromatic and anomeric regions of 2MW6.
      • Fig. S4. NMR structure characterization of inosine substitutions for 2MW6.
      • Fig. S5. Intraresidue aromatic-imino assignments for guanines in the stem of 2MW6.
      • Fig. S6. Exchangeable proton assignments for the structure of 2M6W.
      • Fig. S7. Nonexchangeable 1H and 31P assignments for 5J6U.
      • Fig. S8. Exchangeable proton assignments for 5J6U.
      • Fig. S9. Nonexchangeable 1H assignments for 5J05.
      • Fig. S10. Exchangeable proton assignments for 5J05.
      • Fig. S11. Sequence-specific assignments for 5J4W.
      • Fig. S12. Exchangeable proton assignments for 5J4W.
      • Fig. S13. Nonexchangeable 1H assignments for 5J4P.
      • Fig. S14. Exchangeable proton assignments for 5J4P.
      • Fig. S15. Nonexchangeable 1H and 31P assignments for 2M6V.
      • Fig. S16. Exchangeable proton perturbations for the inosine substitutions on 2M6V.
      • Fig. S17. Exchangeable proton assignments for 2M6V.
      • Fig. S18. NMR experiments for characterization of the 4(−lwd+ln) topology formed by the DNA sequences S069, S067, S036, and S080.
      • Fig. S19. Solution NMR experiments for characterization of the 3(−lwd+ln) topology formed by the DNA sequences S231, S090, S089, S088, and S093.
      • Fig. S20. Solution NMR experiments for characterization of the 2(−lwd+ln) topology formed by the DNA sequences S167, S171, and S172.
      • Fig. S21. Use of riboguanosines to induce folding of the 3(−lwd+ln) topology.
      • Fig. S22. Exchangeable proton assignments for 3(−lwd+ln) topology formed by S090.
      • Table S1. Proton chemical shifts for the structure of 2MFT.
      • Table S2. Proton and phosphorous chemical shifts for structure of 2M6W.
      • Table S3. Proton and phosphorous chemical shifts for structure of 5J6U.
      • Table S4. Proton chemical shifts for the structure of 5J05.
      • Table S5. Proton chemical shifts for the structure of 5J4W.
      • Table S6. Proton chemical shifts for the structure of 5J4P.
      • Table S7. Proton and phosphorous chemical shifts for the structure of 2M6V.
      • Table S8. NMR restraints and structural statistics for the structures of 2MFT.
      • Table S9. NMR restraints and structural statistics for the structures of 2M6W.
      • Table S10. NMR restraints and structural statistics for the structures of 5J6U.
      • Table S11. NMR restraints and structural statistics for the structures of 5J05.
      • Table S12. NMR restraints and structural statistics for the structures of 5J4W.
      • Table S13. NMR restraints and structural statistics for the structures of 5J4P.
      • Table S14. NMR restraints and structural statistics for the structures of 2M6V.

      Download PDF

      Files in this Data Supplement:

    Navigate This Article