Table 1 Primers used for PCR.
Annealing genePrimer sequence
βActForward: GCATTGCTGACAGGATGCAG
Reverse: CATCGTACTCCTGCTTGCTG
Zif-268Forward: ACAGTGGCAACACTTTGTGG
Reverse: ATGTCAGTGTTGGGAGTAGG
FosForward: TTGTAGTGACACCTGAGAGC
Reverse: TCCAGCACCAGGTTAATTCC
SgkForward: AGTGAGAAGGAAGATGCAGG
Reverse: CTGCACACATGGGAAATACG
Cox2Forward: CCACTTCCAACTCAAGTTCG
Reverse: GTTTGAAAGTGTACTCCTGG
Gpd1Forward: AGAGCAGGGAAGGGAACATC
Reverse: AGAGAAAGGGAGGGGATTCA
Sult1a1Forward: TACACAACCATCCCCACTGA
Reverse: GTTTGCCTTGGTTCCCAGTA
BdnfForward: GTGACAGTATTAGCGAGTGG
Reverse: TTCCTTCGTGTAACCCATGG
ArcForward: TCCTGCAGATTGGTAAGTGC
Reverse: CTTGATGGACTTCTTCCAGC
Homer1Forward: ACCTATCTTCAGCACTCGAG
Reverse: GCCGTCTACACTGATTATCC