Table 1 Guide RNA sequences of top 12 exons.
ExonApplicability (30)gRNA/PAM at acceptor sitegRNA/PAM at donor site
5113.0%#1: TGCAAAAACCCAAAATATTTTAG
#2: AAAATATTTTAGCTCCTACTCAG
#3: CAGAGTAACAGTCTGAGTAGGAG*
458.1%#1: TTGCCTTTTTGGTATCTTACAGG
#2: TTTGCCTTTTTGGTATCTTACAG
#3: CGCTGCCCAATGCCATCCTGGAG
537.7%#1: ATTTATTTTTCCTTTTATTCTAG#4: AAAGAAAATCACAGAAACCAAGG
#2: TTTCCTTTTATTCTAGTTGAAAG#5: AAAATCACAGAAACCAAGGTTAG
#3: TGATTCTGAATTCTTTCAACTAG#6: GGTATCTTTGATACTAACCTTGG
446.2%#1: ATCCATATGCTTTTACCTGCAGG#4: GTAATACAAATGGTATCTTAAGG
#2: GATCCATATGCTTTTACCTGCAG
#3: CAGATCTGTCAAATCGCCTGCAG
464.3%#1: TTATTCTTCTTTCTCCAGGCTAG
#2: AATTTTATTCTTCTTTCTCCAGG
#3: CAATTTTATTCTTCTTTCTCCAG
524.1%#1: TAAGGGATATTTGTTCTTACAGG
#2: CTAAGGGATATTTGTTCTTACAG
#3: TGTTCTTACAGGCAACAATGCAG
504.0%#1: TGTATGCTTTTCTGTTAAAGAGG
#2: ATGTGTATGCTTTTCTGTTAAAG
#3: GTGTATGCTTTTCTGTTAAAGAG
433.8%#1: GTTTTAAAATTTTTATATTACAG#4: TATGTGTTACCTACCCTTGTCGG
#2: TTTTATATTACAGAATATAAAAG#5: AAATGTACAAGGACCGACAAGGG
#3: ATATTACAGAATATAAAAGATAG#6: GTACAAGGACCGACAAGGGTAGG
63.0%†#1: TGAAAATTTATTTCCACATGTAG#4: ATGCTCTCATCCATAGTCATAGG
#2: GAAAATTTATTTCCACATGTAGG#5: TCTCATCCATAGTCATAGGTAAG
#3: TTACATTTTTGACCTACATGTGG#6: CATCCATAGTCATAGGTAAGAAG
73.0%†#1: TGTGTATGTGTATGTGTTTTAGG
#2: TATGTGTATGTGTTTTAGGCCAG
#3: CTATTCCAGTCAAATAGGTCTGG
82.3%#1: GTGTAGTGTTAATGTGCTTACAG#4: TGCACTATTCTCAACAGGTAAAG
#2: GGACTTCTTATCTGGATAGGTGG#5: TCAAATGCACTATTCTCAACAGG
#3: TAGGTGGTATCAACATCTGTAAG#6: CTTTACACACTTTACCTGTTGAG
552.0%#1: TGAACATTTGGTCCTTTGCAGGG
#2: TCTGAACATTTGGTCCTTTGCAG
#3: TCTCGCTCACTCACCCTGCAAAG

*Bold sequence indicates the best guide RNAs for myoediting.

†Dual exon skipping (exons 6 and 7).