Research ArticleBIOTECHNOLOGY

Rapid identification of health care–associated infections with an integrated fluorescence anisotropy system

See allHide authors and affiliations

Science Advances  06 May 2016:
Vol. 2, no. 5, e1600300
DOI: 10.1126/sciadv.1600300
  • Fig. 1 PAD system.

    (A) Assay procedure. Bacteria are lysed, and total RNA is extracted. Following the RT-PCR amplification, samples containing amplicons and DNA polymerase are incubated with an all-in-one master mix that has the detection key and the reporter. The resulting fluorescence anisotropy of the sample is then measured. (B) Photograph of a disposable RNA extraction cartridge made in plastic. The device has an RNA extraction chamber packed with glass beads (inset). (C) Photograph of a portable system for fluorescence anisotropy detection. Four separate optical cubes can be plugged into an electronic base station. (D) PAD measurement is controlled through a custom-designed application in a smartphone. The PAD device and the smartphone communicate via Bluetooth.

  • Fig. 2 Optical detection design.

    (A) Schematic of an optical cube. The optical excitation module has an LED, a linear polarizer, and a focusing lens. The emission light is measured by a pair of detector sets, each consisting of a lens, a polarization filter, and a photodiode (PD). (B) Circuit diagram. The on-board computer controls the entire system and communicates with a smartphone. To enhance the signal-to-noise ratio (SNR), the system uses the optical lock-in detection scheme. The intensity of the excitation light is amplitude-modulated, and the resulting emission intensities are mixed with the carrier frequency. The dotted box indicates an optical cube. BPF, band-pass filter; LPF, low-pass filter; AMP, amplifier. (C) The lock-in method significantly improved the signal-to-noise ratio (630 times, 28 dB). (D) The accuracy of the PAD was benchmarked against a commercial plate reader. The measured values show excellent agreements (R2 = 99%). Experiments were performed in triplicate, and the data were displayed as means ± SD. Horizontal and vertical error bars were from the plate reader and the PAD measurements, respectively.

  • Fig. 3 Universal bacteria detection.

    (A) The universal capture key (UNI key) detects a conserved bacterial sequence (N = A for Escherichia, Klebsiella, and Acinetobacter; N = T for Pseudomonas and Staphylococcus). The reporter is composed of a primer, a template, and FAM-DNA. (B) Five different HAI pathogens (106 CFU/ml) were detected with the PAD. The signal levels were statistically identical among concentration-matched bacterial samples. (C) Detection sensitivity. Samples with different bacterial concentrations (E. coli, 10–1 to 108 CFU/ml) were prepared through serial dilution. The limit of detection (LOD) was at the level of a single bacterium. The threshold was set at 3× SD above background signal of the sample without bacteria. All experiments were performed in triplicate and the graphs are displayed as means ± SD.

  • Fig. 4 Assay optimization for POC operation.

    (A) Schematic illustration of UDG-mediated control on carryover contamination. Uracil-containing carryover contaminant was specifically broken down by UDG, which allows for the amplification of the true target DNA only. (B) Uracil-containing contaminants (107 copies) were added to all samples. Contaminated samples produced high signal even in the absence of target bacteria. When samples were treated with UDG, the false-positive signal was eliminated. (C) The PAD reagents were lyophilized to facilitate their transport and extend their shelf life. After 4 weeks of storage in ambient condition, the reagents were used for bacterial detection. No difference was observed between fresh and lyophilized reagents. Bacterial samples in (B) and (C) contained E. coli (106 CFU/ml). All experiments were performed in triplicate, and the data are displayed as means ± SD. RT, room temperature.

  • Fig. 5 Bacteria typing with PAD.

    (A) A set of detection keys specific for HAI pathogens was designed (HAI keys). An Escherichia key is shown as an example. (B) The specificity of HAI keys was tested. The signal was high only in the presence of the target species even in the mixture of other bacterial species. An example of E. coli (106 CFU/ml) detection is shown. (C) Heat map of Δr values obtained for HAI detection. Bacterial concentration was 106 CFU/ml. (D) Detection keys for antibiotic resistance and virulence (ARV keys) were designed for further typing. Two types of methicillin-resistant S. aureus (MRSA; 106 CFU/ml), health care–associated MRSA (HA-MRSA) and community-acquired MRSA (CA-MRSA), were identified by targeting the specific regions in mecA and PVL genes. Three pathogens [methicillin-sensitive S. aureus (MSSA), E. coli, and P. aeruginosa; 106 CFU/ml] were included as controls. All experiments were performed in triplicate. The heat map displays mean values and the bar graphs display means ± SD.

  • Fig. 6 Clinical application of PAD for HAI detection.

    (A) Nine samples from different patients were processed by the PAD for bacterial load (UNI), presence of the HAI species (HAI), and resistance/virulence status (ARV). (B) The clinical samples were also tested by a clinical pathology laboratory (culture and qPCR). The PAD and pathology reports agreed with each other.

  • Table 1 Sequence of detection keys designed for the PAD (see table S1 for other targets).

    PVL, Panton-Valentine leukocidin.

    CategoryTargetDNA sequence (5′ to 3′)
    UNIUniversalCAATGTACAGTATTGTGGAGCATGTGGTTTAATTCGA
    HAIEscherichiaCAATGTACAGTATTGTGGAGGAAGGGAGTAAAGTTAAT
    KlebsiellaCAATGTACAGTATTGTGGAGGCAAGGCGATAAGGT
    AcinetobacterCAATGTACAGTATTGTTCTAGTTAATACCTAGGGATAGTG
    PseudomonasCAATGTACAGTATTGTGGAGGAAGGGCAGTAAGTTAA
    StaphylococcusCAATGTACAGTATTGTGGGAAGAACATATGTGTAAGTAAC
    ARVnucCAATGTACAGTATTGTTGCTTCAGGACCATATTTCTCTAC
    femBCAATGTACAGTATTGTCCAGAAGCAAGGTTTAGAATTG
    mecACAATGTACAGTATTGTCTGCTATCCACCCTCAAACAG
    PVLCAATGTACAGTATTGTCGGTAGGTTATTCTTATGGTGGAG

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/2/5/e1600300/DC1

    table S1. Target sequences recognized by established detection keys.

    table S2. Summary of a set of ARV factors targeted in this study.

    table S3. DNA sequences used in this study.

    fig. S1. Schematic of the plastic cartridge for RNA extraction.

    fig. S2. Comparison between the fluidic cartridge and a commercial column.

    fig. S3. The optical detection system in the PAD.

    fig. S4. Snapshots of a PAD application.

    fig. S5. The circuit diagram of the detection system.

    fig. S6. The effect of dUTP on the PAD assay.

    fig. S7. Portable PAD system.

    fig. S8. Lyophilized probes.

    fig. S9. Electrophoretic band-shift assay.

    fig. S10. Detection of ARV factors.

    fig. S11. Overall assay procedure for clinical samples.

    fig. S12. Universal and species-specific detection of HAI pathogens in clinical samples by the PAD system.

    fig. S13. Detection of ARV factors in clinical samples with PAD (top) and qPCR (bottom).

    References (29, 30)

  • Supplementary Materials

    This PDF file includes:

    • table S1. Target sequences recognized by established detection keys.
    • table S2. Summary of a set of ARV factors targeted in this study.
    • table S3. DNA sequences used in this study.
    • fig. S1. Schematic of the plastic cartridge for RNA extraction.
    • fig. S2. Comparison between the fluidic cartridge and a commercial column.
    • fig. S3. The optical detection system in the PAD.
    • fig. S4. Snapshots of a PAD application.
    • fig. S5. The circuit diagram of the detection system.
    • fig. S6. The effect of dUTP on the PAD assay.
    • fig. S7. Portable PAD system.
    • fig. S8. Lyophilized probes.
    • fig. S9. Electrophoretic band-shift assay.
    • fig. S10. Detection of ARV factors.
    • fig. S11. Overall assay procedure for clinical samples.
    • fig. S12. Universal and species-specific detection of HAI pathogens in clinical samples by the PAD system.
    • fig. S13. Detection of ARV factors in clinical samples with PAD (top) and qPCR (bottom).
    • References (29, 30)

    Download PDF

    Files in this Data Supplement:

Navigate This Article