Research ArticleBIOCHEMISTRY

Antiviral activity of a purine synthesis enzyme reveals a key role of deamidation in regulating protein nuclear import

See allHide authors and affiliations

Science Advances  09 Oct 2019:
Vol. 5, no. 10, eaaw7373
DOI: 10.1126/sciadv.aaw7373
  • Fig. 1 Cellular PFAS negatively regulates RTA-dependent transcriptional activation.

    (A) 293T/RTA cells were infected with lentivirus carrying control (CTL) shRNA or shRNA targeting indicated GAT. At 48 hours after infection, cells were infected with rKSHV.219 and induced with doxycycline for RTA expression. Representative RFP+ and GFP+ cells of the screen were recorded at 24 hours after KSHV infection. Scale bars, 5 μm. (B) RFP+ cells from (A) were quantified at 48 hours after infection by counting five randomly selected areas. The results are shown as the mean ± SD of three independent experiments in duplicate. n = 3. (C) 293T cells were transfected with plasmids containing RTA or the indicated GAT, and a reporter plasmid cocktail. RTA-mediated transcriptional activation of the PAN promoter was determined by luciferase activity at 30 hours after transfection. (D) 293T cells were infected with lentivirus carrying control shRNA (CTL) or shRNA against PFAS and selected with puromycin. Stable 293T cells were transfected with a plasmid containing RTA and a reporter plasmid cocktail. RTA-mediated transcriptional activation of the PAN promoter was determined by luciferase assay at 24 hours after transfection. For (C) and (D), the data are shown as the median ± SD of three independent experiments in duplicate (n = 3). **P < 0.01 and ***P < 0.001, unpaired two-tailed Student’s t test. (E to H) iSLK/rKSHV.219 cells were infected with lentivirus containing control (CTL) shRNA or shRNA against PFAS. Cells were induced with doxycycline (1.0 μg/ml) for the indicated times. When cells were harvested, total RNA was extracted for reverse transcription and RT-PCR analysis with primers specific for TK (or ORF21) and vGAT (or ORF75) (E), whole-cell lysates (WCLs) were analyzed by immunoblotting with antibodies against indicated viral and cellular proteins (F), viral genome copies were quantified by RT-PCR (G), and viral titer in the medium was determined by flow cytometry analysis of a KSHV-infected 293T monolayer (H). For (E) to (H), the data represent three independent experiments (n = 3). For (E), (G), and (H), the results are shown as the median ± SD of three independent experiments. PFU, plaque-forming units.

  • Fig. 2 PFAS deamidates RTA.

    (A and B) iSLK/rKSHV.219 cells were induced with doxycycline (1 μg/ml) and sodium butyrate (1 mM) for 48 hours (A). 293T cells were transfected with indicated plasmids for 24 hours and then either mock-infected or infected with KSHV (multiplicity of infection = 5) for 24 hours (B). WCLs were prepared, and immunoprecipitation was performed. Precipitated proteins and WCLs were analyzed by immunoblotting with indicated antibodies. (C to E) Stable 293T cells with control lentivirus (CTL) or lentivirus encoding shRNA against PFAS were transfected with a plasmid containing RTA (C). 293T cells were transfected with a plasmid containing RTA without or with a plasmid containing the PFAS-ED mutant. WCLs were prepared at 30 hours after transfection and analyzed by two-dimensional gel electrophoresis and immunoblotting with indicated antibodies (D and E). (F) RTA was purified from transfected 293T cells without or with PFAS-ED and analyzed by tandem MS. The mass/charge ratio (m/z) spectrum of the peptide containing D37 was shown with the deamidated D residue highlighted in red. (G and H) GST-RTA(N) and PFAS or PFAS-ED were purified from bacteria and 293T cells, respectively, and analyzed by silver staining (G). BSA, bovine serum albumin. In vitro deamidation was analyzed by two-dimensional gel electrophoresis and immunoblotting (H). All data present three independent experiments (n = 3).

  • Fig. 3 Deamidation reduces RTA-mediated transcriptional activation.

    (A) 293T cells were transfected with a reporter plasmid cocktail and increasing amount of the plasmid containing RTA, RTA-D37, RTA-D225, or RTA-D37,225 (RTA-DD). RTA-dependent transcriptional activation of the PAN promoter was determined by luciferase assay at 30 hours after transfection. (B) 293T cells were transfected with a reporter plasmid cocktail; plasmids containing RTA-WT (WT), RTA-Q37 (Q37), or RTA-DD (DD); and increasing amount of a plasmid containing PFAS. RTA-dependent transcriptional activation of the PAN promoter was determined by luciferase assays. For (A) and (B), the results are shown as the median ± SD of three independent experiments with duplicate (n = 3). (C) 293T cells were transfected with plasmids containing indicated genes. WCLs were analyzed by two-dimensional gel electrophoresis and immunoblotting with antibodies against RTA or FLAG (PFAS-ED). The results represent three independent experiments (n = 3). (D to G) SLK/iBAC.RTA-WT or SLK/iBAC.RTA-Q37 cells were induced with doxycycline (1.0 μg/ml) for the indicated times. Cells were harvested and subjected to analyses by RT-PCR with primers specific for K8, TK, and vGAT (D); viral protein expression by immunoblotting (E); viral genome replication by RT-PCR (F); and viral titer in the medium by flow cytometry analysis of an infected 293T monolayer (G). For (D), (F), and (G), the results are shown as the median ± SD of three independent experiments (n = 3). For (E), the results represent three independent experiments (n = 3).

  • Fig. 4 Deamidation impedes RTA nuclear translocation.

    (A) A pdb file of RTA was modeled using the I-TASSER server from Zhang laboratory (see Methods for detail). Visualization of three-dimensional models of RTA was realized with PyMOL software. N37 and N225 (in green) locate on the surface and flank an NLS (in blue) that is enriched with arginine and lysine residues. (B and C) iSLK cells stably expressing RTA-WT or RTA-DD were analyzed by immunofluorescence microscopy. Representative images were shown. Scale bars, 5 μm (B). Cells with predominant nuclear RTA staining were counted (C). The results are shown as the median ± SD of three independent experiments (n = 3). (D) iSLK stable cell lines as described in (B) were harvested. WCLs were prepared and subjected to sequential centrifugation to obtain cytosolic (C) and nuclear (N) fractions. WCLs, cytosolic fractions, and nuclear fractions were analyzed by immunoblotting with indicated antibodies. (E) SLK/iBAC.RTA-WT (left) or SLK/iBAC.RTA-Q37 (right) cells were induced with doxycycline (1 μg/ml) and sodium butyrate (1 mM) for 24 or 72 hours. Cells were harvested at the indicated times and subjected to subcellular fractionation analysis by sequential centrifugation to obtain cytosolic (C) and nuclear (N) fractions that were analyzed by immunoblotting with indicated antibodies. (F) Lytic reactivated SLK/iBAC.RTA-WT or SLK/iBAC.RTA-Q37 cells were fixed at 24 or 72 hours after induction and analyzed by confocal microscopy. Representative images were shown. Scale bars, 20 μm. The results shown in (D) to (F) represent three independent experiments (n = 3).

  • Fig. 5 Deamidation impairs RTA binding to importin.

    (A) 293T cells were transfected with plasmids containing FLAG-tagged RTA-WT and the indicated V5-tagged importins. WCLs were incubated with anti-V5 antibody. The precipitated proteins and WCLs were analyzed by immunoblotting with indicated antibodies. (B) Glutathione agarose loaded with GST or recombinant GST–importin β1 was incubated with purified RTA. Precipitated proteins and RTA (input) were analyzed by immunoblotting with anti-RTA antibody, while GST and GST–importin β1 were analyzed by Coomassie staining (bottom). (C) SLK/iBAC.RTA-WT cells were induced with doxycycline (1 μg/ml) for 24 hours and then transfected with a plasmid containing EGFP-bimax2 for 24 hours. Cells were analyzed by immunofluorescence staining and microscopy. (D) Glutathione agarose loaded with GST fusions containing either importin β1 (imp-β1) or β2 (imp-β2) was incubated with WCLs containing RTA-WT (WT) or RTA-DD (DD). Precipitated proteins and WCLs (Input) were analyzed by immunoblotting with anti-RTA antibody (right). GST–importin β1 and GST–importin β2 were analyzed by Coomassie staining. (E) 293T cells were transfected with plasmids containing RTA-WT (WT) or RTA-DD (DD) mutant. WCLs were prepared and precipitated with control immunoglobulin G (IgG) or antibody against importin β1 (Imp-β1). Precipitated proteins and WCLs were analyzed by immunoblotting with indicated antibodies. (F) iSLK/rKSHV.219 cells were induced with doxycycline (0.5 μg/ml) and sodium butyrate (1 mM) for the indicated times. Immunoprecipitation and immunoblotting were performed as described in (E). (G) iSLK/rKSHV.219 cells were transduced with control lentivirus (CTL) or lentivirus encoding shRNA against PFAS, followed by doxycycline and sodium butyrate induction for 72 hours. Cells were harvested for cellular fractionation to obtain cytosolic (C) and nuclear (N) fractions that, along with WCLs, were analyzed by immunoblotting with indicated antibodies. The results shown in (A), (B), and (D) to (G) represent three independent experiments (n = 3).

  • Fig. 6 PFAS-mediated deamidation regulates the nuclear import of RTA proteins of gamma herpesviruses.

    (A) Alignment of RTA proteins of KSHV, RRV, EBV, HVS, and MHV68 shows the bipartite NLS and the two deamidation sites corresponding to N37 and N225 of KSHV RTA. (B) 293T stable cells carrying control shRNA or PFAS shRNA were transfected with a plasmid containing RRV RTA (rRTA), EBV RTA (eRTA), HVS RTA (hRTA), or MHV68 RTA (mRTA). WCLs were prepared at 30 hours after transfection and analyzed by two-dimensional gel electrophoresis and immunoblotted for RTA (left). WCLs were analyzed by immunoblotting with antibodies against PFAS and RTA (right). (C) 293T cells transfected with plasmids containing rRTA, eRTA, hRTA, or mRTA. WCLs were precipitated with a control IgG or antibody against importin β1. Precipitated proteins and WCLs were analyzed by immunoblotting with indicated antibodies. (D) Glutathione agarose loaded with GST or GST–importin β1 (GST–imp β1) were incubated with WCLs prepared from 293T cells transfected with a plasmid containing eRTA, hRTA, or mRTA, without or with a plasmid containing PFAS-ED. Precipitated proteins and WCLs were analyzed by immunoblotting with indicated antibodies. (E) 293T cells were transfected with wild type (WT) or the deamidated mutant (DD/D) of rRTA, hRTA, or eRTA. Sites of N>D mutations were highlighted in (A). Nuclear (N) and cytosolic (C) fractions were obtained by sequential centrifugation and analyzed by immunoblotting with indicated antibodies. WCLs were analyzed for the expression of RTA wild type and the DD/D mutant (right panels). The results shown in (B) to (E) represent three independent experiments (n = 3).

  • Table 1 Primers for qRT-PCR.

    CADTACGTGTCTCTCGCTCCTTCCTGAGGCACCTTTACTCCCA
    CTPS1AGCTTGGCAGAAGCTCTGTACCAACTGCATCCCTAAGCAC
    CTPS2AACCGAGGACCCTGTGAAATTCACTGCTAGTTGCATCCCA
    GFPT1ACGGGAGACAGATTGTGGAGATCAGGCAGCCGTTTCAATC
    GFPT2CTCATCGTGATTGGCTGTGGGCAAACGTCATCCCTGAACA
    GMPSCAGAGAGTCAAAGCCTGCACACCCTGCACACCTACAGTTT
    NADSYN1CACACGGTTCCCATGTCCTATGTGCAGAGGCCTCCATAAG
    PFASCCAGGGAAAGGAAGTCCGATGTGGTTGCACCACTAAAGGG
    PPATCGAGAGGAATGTGGCGTGTTCCCACGAGTCCCAGAGTGAT
    ASNSTGCTGGCAGGATCAACTAGGGTGTTGTGGTGCATGCCTAT
    ASNSDGGGCGGGACTAAAGGAACTAGAAGCAAACCAGACTGCACA
    ORF21AATCAAGCACCTCCACAACCGCAAACCGACTGGCAAAAAT
    PANCCGCCGATTGTGGGTTGATTTTTTGTTCTGCGGGCTTATGGAG
    ORF57TGCTCTTGGCCTTTGTCCTATGCACAAGCTGTGATGTTCC
    ORF59CTATGCCAGCGTCGAGTACAGGAAGGCAGTGGAGACGTTA
    K8CAAGAGGCGACTACATAGAAAGATCACATACTTCGGCCTTAAC
    ORF75TGGAGCTGTTTGTCTCCAAGGTTGAGAAAGTGCTCTGCCA
  • Table 2 Primers for iBAC16-RTA construction.

    Kan-RTA-37D-FCGAACTGAAGGCCCAACTCTACCAGTGTGTGCTCCTTATAGATGACGCATACGAAACAATTAGGGATAACAGGGTAATCGATTTATTC
    Kan-RTA-37D-RTTAGGTCACTGGGATCGTAGATTGTTTCGTATGCGTCATCTATAAGGAGCACACACTGGTGCCAGTGTTACAACCAATTAACC
    Kan-RTA-225D-FGCCGCTGGAGATCATGACCAAGGGTCAGCTCGCCCCTGAAGACTTTTACAGCATCACCGGTAGGGATAACAGGGTAATCGATTTATTC
    Kan-RTA-225D-RGCCGGCGTTTCTCAGCAGAACCGGTGATGCTGTAAAAGTCTTCAGGGGCGAGCTGACCCTGCCAGTGTTACAACCAATTAACC
    Kan-RTA-37Q-FCGAACTGAAGGCCCAACTCTACCAGTGTGTGCTCCTTATACAAGACGCATACGAAACAATTAGGGATAACAGGGTAATCGATTTATTC
    Kan-RTA-37Q-RTTAGGTCACTGGGATCGTAGATTGTTTCGTATGCGTCTTGTATAAGGAGCACACACTGGTGCCAGTGTTACAACCAATTAACC

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/5/10/eaaw7373/DC1

    Fig. S1. Cellular glutamine amidotransferases in KSHV lytic replication.

    Fig. S2. PFAS restricts KSHV lytic replication.

    Fig. S3. PFAS deamidates RTA.

    Fig. S4. Deamidated RTA is impaired to activate KSHV lytic gene expression.

    Fig. S5. Deamidation-resistant RTA-Q37 more potently induces KSHV lytic replication.

    Fig. S6. Deamidation impairs RTA binding to importin.

    Fig. S7. PFAS deamidates RTAs of other gamma herpesviruses.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. Cellular glutamine amidotransferases in KSHV lytic replication.
    • Fig. S2. PFAS restricts KSHV lytic replication.
    • Fig. S3. PFAS deamidates RTA.
    • Fig. S4. Deamidated RTA is impaired to activate KSHV lytic gene expression.
    • Fig. S5. Deamidation-resistant RTA-Q37 more potently induces KSHV lytic replication.
    • Fig. S6. Deamidation impairs RTA binding to importin.
    • Fig. S7. PFAS deamidates RTAs of other gamma herpesviruses.

    Download PDF

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article