Research ArticleCELL BIOLOGY

Nanoscale coupling of endocytic pit growth and stability

See allHide authors and affiliations

Science Advances  27 Nov 2019:
Vol. 5, no. 11, eaax5775
DOI: 10.1126/sciadv.aax5775
  • Fig. 1 Coupling of CCP growth and stability via the early-acting endocytic FBAR domain protein FCHo2.

    (A) Snapshots of clathrin clusters observed in simulations over time in the presence of 180 clathrin, 180 AP2, and 50 FCHo2 molecules. (B) Number of clathrin molecules per cluster as a function of cluster lifetime. The lifetime is measured in units of 106 simulation time steps. (C) Example kymograph derived from dual-color TIRF microscopy analysis of HeLa cells coexpressing eGFP-FCHo2 and mRFP–clathrin light chain. Scale bar, 1 μm. (D to F) Early endocytic protein content and CCP lifetime are correlated. (D) Normalized maximum intensity of clathrin (red) and FCHo2 (green) for different lifetime cohorts as mean intensity (solid line) and SD (shaded area). CCP lifetime closely correlates with clathrin and FCHo2 intensity. (E) Clathrin content and CCP lifetime are correlated. Normalized mean intensity of mRFP-clathrin for different lifetime cohorts (30, 40, 50, 60, 70, and 80 s) from n = 15 cells with >1500 trajectories per cell. (F) FCHo2 content and CCP lifetime are correlated with FCHo2 being recruited preferentially to long-lived CCPs. Normalized mean intensity of eGFP-FCHo2 for different lifetime cohorts (30, 40, 50, 60, 70, and 80 s) from n = 15 cells with >1500 trajectories per cell. (G) FCHo2 is corecruited with clathrin to CCPs but dissociates prior to clathrin. Lag times between clathrin and FCHo2 were calculated from half-maximum intensity time points of each color (clathrin-FCHo2) for the CCP initiation phase (black) or the CCP departure phase (blue). Means ± SD from the same data set as in (D). One-sided t test, ***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05. ns, not significant.

  • Fig. 2 Loss of FCHo2 reduces CCP size and clathrin content, shortens CCP lifetime, and impairs invagination of early endocytic intermediates.

    (A) Snapshots of clathrin clusters observed in simulations over time in the presence of 180 clathrin, 180 AP2, and either 5 (left) or 50 (right) FCHo2 molecules. (B) Average lifetime of clathrin clusters observed in simulations in the presence of 50 or 5 FCHo2 molecules. The lifetime is measured in units of 106 simulation time steps. (C) Loss of FCHo2 protein expression by lentiviral knockdown. Immunoblot analysis of puromycin-selected Cos7 cells transduced with lentiviruses expressing nonsilencing control shRNA (shNS) or shRNAs targeting FCHo2 (shFCHo2). Actin was analyzed as a control protein. (D) Example kymograph derived from TIRF microscopy analysis of lentivirally transduced puromycin-selected Cos7 cells expressing mRFP–clathrin light chain (CLC). Left: shNS-expressing control cells. Right: shFCHo2-expressing cells. Scale bar, 1 μm. (E and F) Loss of FCHo2 shortens CCP lifetime. (E) Mean cumulative lifetime distribution for all cells (means ± SD in shaded area). Cumulative lifetime distribution is measured in each cell as a function of CCP lifetime, normalized to the value for the 60-s lifetime bin, and subsequently averaged between cells (shNS, n = 17 cells; shFCHo2, n = 14 cells; both from three independent experiments). (F) Distribution of time constants λ of exponential fits to the cumulative lifetime functions. Data from three independent experiments (with shNS n = 17 cells, shFCHo2 n = 14 cells) are shown, where λ = 72 ± 25 s for shNS and λ = 27 ± 7 s for shFCho2. (G) FCHo2 is dispensable for CCP nucleation. Total CCP initiation density including CCPs of the full range of lifetimes within the constrained population is found to be nonsignificantly different between control (shNS) and FCHo2-depleted Cos7 cells (P = 0.6142, t test of shFCHo2 versus shNS). (H) Loss of FCHo2 reduces the clathrin content of CCPs. Maximal clathrin intensity of CCP trajectories as function of trajectories’ total lifetimes for shNS (black, n = 17 cells from three independent experiments) and shFCHo2 (blue, n = 14 cells from three independent experiments). Two-sided t test, *P ≤ 0.05. (I) FCHo2 loss reduces CCP density. Quantitative EM analysis of clathrin-coated endocytic intermediates in control (shNS) and FCHo2-depleted (shFCHo2) HEK293T and Cos7 cells. Bar diagram detailing the total density of clathrin-coated endocytic structures per micrometer cell perimeter. Cos7 cells: n = 3 experiments with a total of 42 cell profiles analyzed for shNS and shFcho2. HEK293T: n = 2 experiments with a total of 35 (shNS) and 36 cell profiles analyzed (shFcho2). Means ± SEM. (J) FCHo2 loss reduces the number of shallow early endocytic intermediates and free CCVs. Quantitative EM analysis of clathrin-coated endocytic intermediates in control (shNS) and FCHo2-depleted (shFCHo2) cells. Morphological groups were shallow, nonconstricted U-shaped, constricted Ω-shaped pits, or structures containing complete clathrin coats (CCVs). Bar diagram detailing the abundance of different CCS per micrometer cell perimeter. Analysis of 35 (shNS) and 36 cell profiles (shFcho2) depicted as means ± SEM. (K) Defective invagination and reduced size of early-stage endocytic intermediates in FCHo2-depleted cells. Analysis of the depth of clathrin-coated shallow early-stage endocytic intermediates in control (shNS) or FCHo2-depleted (shFCHo2) cells. A total of 27 and 31 cell profiles from two experiments were analyzed. Box plot shows the mean with 25th and 75th percentiles, and error bars represent minimum and maximum. Student’s t test, (F to K): ***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05.

  • Fig. 3 FCHo2 couples CCP growth and lifetime via its membrane-deforming FBAR and AP2-activating APA domains.

    (A) Efficient lentiviral depletion of FCHo1, FCHo2, or clathrin heavy chain (CHC) from Cos7 cells. Immunoblot analysis of Cos7 cells transduced with lentiviruses expressing nonsilencing control shRNA (shNS) or shRNAs targeting FCHo1 (shFCHo1), FCHo2 (shFCHo2), or clathrin heavy chain (shCHC). Actin was analyzed as a loading control. (B) Representative images of Tf-CME in Cos7 cells transduced with lentiviruses as in (A). Scale bar, 10 μm. (C) Loss of FCHo2 impairs CME. Quantification of representative data shown in (A). One-sample t test, ***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05. (D) FCHo2 assembles at the rim of CCPs. Representative dual-color SD-dSTORM images of CCPs in methanol-fixed HeLa cells stained for endogenous FCHo2 (green) and AP2 (red). Scale bar, 100 nm. (E) FCHo2 assembles at the rim of CCPs. Averaged SD-dSTORM signal from 286 CCPs from six cells. Ring diameters for FCHo2 (225 ± 12 nm) and AP2 (175 ± 17 nm) were significantly different (P = 0.00029, t test; n = 6). Scale bars, 100 nm. (F) Schematic representation of the domain structures of FCHo1, FCHo2, and the corresponding truncation or deletion mutants and chimeras used in this study. (G) Representative spinning disk confocal images of HeLa cells expressing the indicated FCHo1 and FCHo2 truncation or deletion mutants and chimeras tagged with the hemagglutinin (HA) epitope. Cells were fixed and colabeled with antibodies for the HA tag and endogenous AP2α. Scale bar, 1 μm. wt, wild-type. (H) FCHo2 function in CME depends on its membrane-deforming FBAR domain and the ability of its APA domain to activate AP2. Normalized Tf-CME in control (shNS), clathrin (shCHC), or FCHo2-depleted HEK293T cells expressing the indicated FCHo2 deletion mutants or chimeras tagged with the HA epitope. Gray area indicates range between shFCHo2 and shFCHo2/rescue. Data are from n = 5 to 8 independent experiments as indicated at the bottom of each bar. Means ± SEM, one-sample t test (**P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05).

  • Table 1 Antibodies used in this study.

    Used dilutions for immunofluorescence (IF) and Western blotting (WB) and clone or catalog number (clone/order) are provided. GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

    AntibodySpeciesClone/orderSourceDilution IFDilution WB
    FCHo2RabbitA303-396ABethyl1:200
    FCHo2RabbitRA130H. McMahon1:2001:1000
    FCHo1Mousesc-105351Santa Cruz1:100
    β-ActinMouseac-15Sigma-Aldrich1:10,000
    Clathrin heavy chainRabbitab21679Abcam1:2001:1000
    Dynamin 1 + 2Mouse41BD Biosciences1:500
    GAPDHRabbit1:5000
    GFPMouse3E6Invitrogen A-111201:200
    α-TubulinMouseDM1ASigma T96261:1000
    Tf receptorMouseAb8598Abcam1:1000
    Hip1RMouseSAB1406767Sigma1:1000
    AP2MouseAP-6Homebrew from hybridoma1:1001:1000
    HAMouseHA.11Babco1:2001:1000
    HARat9E7Chromotek1:1000
    Anti-rat AF647Goat712-605-153Jackson Imm. Res.1:200
    Anti-mouse AF568GoatA11031Thermo1:200
    Anti-mouse CF647Goat20281Biotium1:200
    Anti-rabbit CF680Goat20067Biotium1:200
  • Table 2 List of plasmids used in this study.

    VSVG, vesicular stomatitis virus glycoprotein; aa, amino acid; IRES, internal ribosome entry site.

    NameBackboneSpecies and additional
    information
    Primers or reference
    psPAX2Plasmid coding for lentiviral
    packaging GagPol
    Addgene 12260 from Trono Lab
    pMDG2Plasmid coding for VSVG envelopeAddgene 12259 from Trono Lab
    pGIPZ nonsilencingPlasmid coding for lentiviral
    genome containing shRNA, IRES,
    and TurboGFP under hCMV
    promoter
    Thermo Scientific Open Biosystems
    pmRFP-CLCmRFP-C1mRFP–clathrin light chain
    peGFP-FCHo2peGFP-C1Mouse full-length FCHo2A gift from H. McMahon, see (16)
    pHA-C1peGFP-C1
    (Clontech)
    Modified backbone with HA tag
    used for creating HA-labeled
    constructs
    Age I–HA:
    CCGGTCGCCACCATGGCGTACCCATACGACGTCCCAGACTACGCGCT;
    HA–C1–Brs GI:
    TAGAGCGCGTAGTCTGGGACGTCGTATGGGTACGCCATGGTGGCGA
    pHA-FCHo2 wtpHA-C1Mouse full-length FCHo2 with
    HA-tagged backbone
    Cloned from peGFP-FCHo2 (16) using Age I/Bsr GI
    pHA-FCHo1pHA-C1Full-length mouse FCHo1 in
    HA-tagged backbone
    Cloned from FCHo1-pmCherryC1 (Addgene 27690)
    pHA-FCHo2 F38E
    W73E
    pHA-C1Mouse FCHo2, dimerization defectCloned from peGFP-FCHo2 F38E W73E (16)
    pHA-FCHo2 K146E
    K165E
    pHA-C1Mouse FCHo2, membrane binding
    mutant
    Cloned from peGFP-FCHo2 K146E K165E (16)
    pHA-FCHo2
    FBAR-APA
    pHA-C1Mouse FCHo2 aa 1–394 (F-BAR
    domain and APA domain)
    Forward: CATGGTCCTGCTGGAGTTCGTGAC; reverse:
    AATTCTCGAGTCAGTGTCTAGATACTGCTGGGG
    pHA-FCHo2 APA μHDpHA-C1Mouse FCHo2 APA and μHD
    domains (306–873)
    Forward: ATTTGTACAAGGAATGTCCTGACTTAGATTCG; reverse: rev_
    eGFP_C
    pHA FCHo2 APApHA-C1Mouse FCHo2 aa 306–394 (APA
    domain)
    Forward: ATTTGTACAAGGAATGTCCTGACTTAGATTCG; reverse:
    AATTCTCGAGTCAGTGTCTAGATACTGCTGGG
    pHA FCHo2 ΔAPApHA-C1Mouse FCHo2 deletion of aa
    306–394 (APA domain)
    pHA-FCHo2
    FBAR FCHo1
    pHA-C1Chimera: mouse FCHo1 aa 1–353,
    mouse FCHo2 aa 356–873
    Reverse: AATTGGTACCTTTTATTTAACTCATCGACTTTCTGC
    pHA-FCHo2
    FBAR FBP17
    pHA-C1Chimera: human FBP17 aa 1–368,
    mouse FCHo2 aa 356–873
    Reverse: AATTGGTACCTTTTATTTAACTCATCGACTTTCTGC
    pHA-FCHo2
    FBAR Pacsin1
    pHA-C1Chimera: rat Pacsin1 aa 1–306 + 77
    aa linker, mouse FCHo2 aa 356–873
    Forward: AATTTGTACACAGATCTCGAGCTCAAGCTTGCCACC; reverse:
    AATTGGTACCTCTTGGGGTTGGCGCCACC
    pHA-FCHo2
    FBAR Pacsin2
    pHA-C1Chimera: rat Pacsin2 aa 1–306 + 76
    aa linker, mouse FCHo2 aa 356–873
    Forward: AATTTGTACAaCGGACTCGGATCCGAATTCATGTC; reverse:
    AATTGGTACCTCTTAATGTCCTCCTTCTCACTG
    pHA-FCHo2
    NBAREndoA1-
    pHA-C1Chimera: rat endophilin A1
    aa1–256, mouse FCHo2 aa356–873
    Forward: AATTTGTACAGATCCATGTCGGTGGC; reverse:
    AATTGGTACCTCTGATATTCCCTTCTTGGTTG

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/5/11/eaax5775/DC1

    Fig. S1. Automatic detection, filtering, and quantification of CCP dynamics from TIRF movies.

    Fig. S2. FCHo2 arrives as early as clathrin is linearly recruited and leaves CCPs before scission.

    Fig. S3. Impaired Tf-CME in FCHo2-depleted HEK293T and HeLa cells.

    Fig. S4. EM analysis of clathrin-coated endocytic structures following lentiviral knockdown of FCHo2 protein expression.

    Fig. S5. Expression of HA-tagged FCHo2 mutants, deletions, and chimeras.

    Fig. S6. Limited diffusion of plasma membrane Harvey rat sarcoma viral oncogene homolog (hRas)–SNAP into the center of CCPs delineated by eGFP-FCHo2.

    Table S1. Interaction energies between the different proteins and the proteins and the membrane, in units of kBT.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. Automatic detection, filtering, and quantification of CCP dynamics from TIRF movies.
    • Fig. S2. FCHo2 arrives as early as clathrin is linearly recruited and leaves CCPs before scission.
    • Fig. S3. Impaired Tf-CME in FCHo2-depleted HEK293T and HeLa cells.
    • Fig. S4. EM analysis of clathrin-coated endocytic structures following lentiviral knockdown of FCHo2 protein expression.
    • Fig. S5. Expression of HA-tagged FCHo2 mutants, deletions, and chimeras.
    • Fig. S6. Limited diffusion of plasma membrane Harvey rat sarcoma viral oncogene homolog (hRas)–SNAP into the center of CCPs delineated by eGFP-FCHo2.
    • Table S1. Interaction energies between the different proteins and the proteins and the membrane, in units of kBT.

    Download PDF

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article