Research ArticleBIOCHEMISTRY

Chromatin capture links the metabolic enzyme AHCY to stem cell proliferation

See allHide authors and affiliations

Science Advances  06 Mar 2019:
Vol. 5, no. 3, eaav2448
DOI: 10.1126/sciadv.aav2448
  • Fig. 1 Dm-ChP for chromatin-bound proteome profiling.

    (A) Schematic representation of the Dm-ChP technique for chromatin-bound proteome profiling. Cells were incubated with a very low amount of EdU during a long pulse (0.1 μM EdU for 20 hours) to label the whole genome. The DNA and associated proteins were cross-linked with 1% formaldehyde (FA) for 10 min, and the cells were lysed (step 1). The EdU-labeled DNA was conjugated to a biotin group by a Click reaction (step 2) and then fragmented by sonication (step 3). Labeled DNA fragments were isolated using streptavidin magnetic beads (step 4) and eluted using Laemmli buffer (step 5). Eluted samples were analyzed by Western blot or high-resolution MS (step 6). μM, micromolar. LC-MS/MS, liquid chromatography–tandem mass spectrometry (B) ESCs were pulsed with EdU at the times indicated and then stained with an anti-RP32 antibody, and EdU was detected by a Click reaction. Insets show magnifications of the image. DAPI, 4′,6-diamidino-2-phenylindole. (C) Input material and eluates prepared by Dm-ChP from nonincubated (−EdU) and EdU-incubated mouse ESCs (+EdU) were analyzed in triplicate by dot blot using the indicated antibodies. Dashed red circles indicate the position of the dotted samples. (D) Experimental scheme for the proteomic survey of pluripotent ESCs using Dm-ChP with high-resolution MS (Dm-ChP–MS). (E) Volcano plot of the 1812 proteins identified in the proteomic analysis in ESCs. Proteins enriched in EdU-ESCs are shown on the right, and those enriched in (non-EdU) ESCs are shown on the left. FDR, false discovery rate. (F) Pie chart representing the functional groups, by manual curation, of the 488 chromatin-bound proteins found in ESCs by Dm-ChP–MS and Significance Analysis of INTeractome (SAINT). The number of proteins is indicated in parentheses. (G) Venn diagram indicating the overlap between the manually curated list of previously reported chromatin modifiers [from (6365)] and our Dm-ChP–MS dataset. The list includes the top expressed chromatin modifiers in mouse ESCs (RPKM > 50). RPKM, Reads Per Kilobase Million. (H) Selected functional protein networks associated with chromatin organization and remodeling, DNA modification, and pluripotency. Related subnetworks are depicted separately according to their functional roles. The legend indicates the color code for the log2 of the fold changes in +EdU/−EdU conditions and the presence and significance of each protein in our dataset. Selected protein complexes are indicated in red. ACF (ID_925), adenosine 5′-triphosphate–dependent chromatin assembly factor complex; Mll2 (ID_6460), mixed-lineage leukemia 2 complex; NoRC (ID_5694), nucleolar remodeling complex; NuRD (ID_61), nucleosome remodeling deacetylase complex; PRC2 (ID_996), polycomb repressive complex 2; Sin3A (ID_283), paired amphipathic helix protein Sin3a complex; WSTF (ID_236), Williams syndrome transcription factor–containing complex (abbreviations for protein complexes are given with the identifier number of the archetypic complex at the CORUM database). ADP, adenosine 5′-diphosphate.

  • Fig. 2 The AHCY enzyme is recruited to chromatin in pluripotent ESCs.

    (A) Scheme of the methionine (Met) metabolic pathway. AHCY is depicted in red. MAT, methionine adenosyltransferase; MS, methionine synthase; MTase; methyltransferase; HCy, Homocysteine. (B) Input and chromatin isolated by Dm-ChP from ESCs, under serum-containing or 2iLIF culture conditions, with nonincubated (minus) or EdU-incubated cells (plus), were analyzed by Western blot using the indicated antibodies. H3 was used as a control of efficient chromatin purification by Dm-ChP. Note that specific AHCY bands correspond to the dimer in size that is resistant to reverse cross-linking by heating. (C) shControl and shAhcy-KD ESCs were stained with a specific anti-AHCY antibody and show the loss of a specific nuclear signal in all three shAhcy-KD cells. Nuclei were counterstained with DAPI. (D) Single-cell expression values of Ahcy during mouse development, from zygote to the late blastocyst stage. Each dot represents a cell from the original data of (33). scRNA-seq, single cell RNA-seq. (E) Representative confocal section covering the inner cell mass and the trophectoderm layers of mouse late preimplantation blastocysts (E4.5) immunostained for AHCY or NANOG.

  • Fig. 3 AHCY occupies transcription start sites (TSS) of highly expressed genes in ESCs.

    (A) Genomic visualization of AHCY ChIP-seq at several target sites. (B) AHCY ChIP-seq validation by ChIP-qPCR at TSS of AHCY target genes (Map2k5, Rbl1, Hdac2, Rps20, Rpl18, Rpl4, and Rpl17) and AHCY nontarget genomic regions (TSS of Spink2 and intergenic region at Chr15) as a negative control. ChIP-qPCRs were performed in shControl cells (n = 3) and shAhcy-KD ESCs with three independent shRNAs, showing the specific reduction in AHCY binding in shAhcy-KD ESCs (mean ± SD of three technical replicates). IgG, immunoglobulin G. (C) Genomic distribution of ChIP-seq peaks of AHCY. The spie chart represents the distribution of AHCY peaks corrected by the genome-wide distribution of each gene genomic feature (indicated in the background circle distribution). The spie charts indicate that AHCY preferentially occupies TSS neighborhood regions, including 5′ untranslated region (5′UTR) and proximal promoter regions. (D) Heat map showing the AHCY ChIP-seq occupancy profile around TSS (±5 kb) in two independent ChIP-seq replicates, with IgG as a negative control. (E) Meta-gene plot showing the AHCY ChIP-seq occupancy profile (red line) around TSS (±2 kb). IgG distribution is indicated by the gray line. (F) Box plots indicating the gene expression for the whole transcriptome in naïve ESCs, fractionated into five groups, from non-expressed genes (black box plot) to the highly expressed genes (light blue box plot). The red box plot indicates the expression of AHCY target genes. (G) Percentage of AHCY co-occupancy with chromatin factors from Myc, core, and PcG networks. (H) Pathway enrichment analysis of AHCY target genes. EGFR1, epidermal growth factor receptor 1; MAPK, mitogen-activated protein kinase; TNF-α, tumor necrosis factor–α; and NF-κB, nuclear factor κB.

  • Fig. 4 AHCY promotes the expression of ribosomal protein genes, protein synthesis, and proliferation in ESCs.

    (A) Total cell extracts from shControl- or shAhcy (three independent shRNAs)–infected cells were analyzed by Western blot with the indicated antibodies. The protein vinculin was used as a loading control. (B) Images of ESC colonies growing under naïve culture conditions, displaying the typical dome shape in both shControl and shAhcy-KD ESCs. Scale bar, 100 μm. (C) Histogram indicating the relative number of shControl and shAhcy-KD ESCs after 48 hours of growing under naïve conditions (mean ± SE, n = 4 for shControl, shAhcy#1, and shAhcy#3 and n = 3 for shAhcy#2; *P ≤ 0.05, **P ≤ 0.01, two-tailed Student’s t test). (D) Cell cycle profile of shControl and shAhcy-KD ESCs analyzed by fluorescence-activated cell sorting (FACS). PI, propidium iodide. (E) Histogram indicating the percentage of shControl and shAhcy-KD ESCs in different phases of the cell cycle (mean ± SE; *P ≤ 0.05, two-tailed Student’s t test; n = 2 shControl and n = 5 shAhcy). (F) Gene set enrichment analysis (GSEA) plots for the gene expression data generated by RNA-seq from cells infected with shControl (n = 2) or shAhcy (n = 5). The complete mouse genome was ranked according to their log2 fold change expression between shControl- and shAhcy-infected cells. Genes down-regulated in shAhcy are distributed on the left of the plot, and those up-regulated are distributed on the right. The top significant KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway is shown together with the computed nominal P value, the q value, and the normalized enrichment score (NES). Distribution of ribosomal protein genes is indicated in blue lines, as well as the curve for the evolution of the gene density. (G) Violin plots indicating the expression of ribosomal protein genes calculated from RNA-seq. Each dot represents average expression of a ribosomal protein gene. Red dots indicate the ribosomal protein genes targeted by AHCY. ***P < 0.001, Wilcoxon matched pair signed-rank test. (H) Histogram indicates the relative incorporation of the methionine analog L-HPG in shControl and shAhcy-KD ESCs as analyzed by FACS. (I) Quantification of high and low percentage of L-HPG–incorporated cells (mean ± SE; *P ≤ 0.05, two-tailed Student’s t test; n = 3 shControl and n = 9 shAhcy). (J) Mouse preimplantation embryos (E3.5) were cultured ex vivo in the presence of 3-deazaadenosine (3-DZA) or DMSO (as vehicle) for 18 hours. Embryos were then pulsed once with L-HPG and labeled using the Click reaction. Developmental progression of embryos was evaluated by (K) counting the number of cells per embryo or (L) quantifying the total L-HPG incorporation per embryo and normalizing this by the number of cells. *P < 0.05, **P < 0.01, ***P < 0.001, Mann-Whitney test two-tailed; n = 3 for E3.5, and n = 10 for 18-hour vehicle and n = 9 for 18-hour AHCYi. (M) Model for the AHCY-dependent proliferation control of pluripotent cells. Nutrients are the primary source of cellular methionine, which, in turn, can be incorporated into the newly synthetized proteins (1) or it can be used to produce SAM as a methyl donor for MTases (2). Elevated levels of SAH produced by the transfer of the methyl group can inhibit the MTases. AHCY is recruited to highly transcribed genes, such as ribosomal protein genes, to favor the efficient methylation reactions at these loci and the production of mature transcripts in an efficient manner. Elevated ribosomal protein production sustains the rate of protein synthesis and proliferation in ESCs.

  • Table 1 List of human cell lines used in this study.

    CIMA, Centro de Investigación Médica Aplicada, Spain; CRG, Center for Genomic Regulation, Spain; EC, epithelial carcinoma; FBS, fetal bovine serum (Hyclone); IMIM, Institut Hospital del Mar d’Investigacions Mèdiques, Spain; IRB, Research Institute Barcelona, Spain; LC, leukemic cells; NaPyr, sodium pyruvate (Gibco); P/S, penicillin-streptomycin (Gibco); Qx, glutaMAX (Gibco); RPMI 1640 (Gibco); GM-CSF, granulocyte-macrophage colony-stimulating factor; h.i., heat inactivated.

    Cell line nameOriginObtained fromMediaEstimated
    doubling time
    HELLCPuri Fortes’ lab (CIMA)90% RPMI 1640 + 10 FBS + MEM + P/S + Qx + NaPyr35 hours
    NB4LCLuciano Di Croce’s lab (CRG)90% RPMI 1640 + 10 FBS + P/S + Qx35–45 hours
    OCI-AML2LCPuri Fortes’ lab (CIMA)90% DMEM +10 FBS + MEM + P/S + Qx + NaPyr30–50 hours
    Skno-1LCDSMZ (Deutsche Sammlung von
    Mikroorganismen und Zellkulturen)
    90% RPMI 1640 + 10% FBS + GM-CSF35–50 hours
    K562LCLuciano Di Croce’s lab (CRG)90% RPMI 1640 + 10 FBS + P/S + Qx30–40 hours
    LoVoECIMIM repository90% RPMI 1640 + 10 FBS + MEM + P/S + Qx + NaPyr48 hours
    SW480ECIMIM repositoryDMEM + 10% FBS + 10 FBS + P/S + Qx25–30 hours
    HT-29ECIMIM repositoryDMEM + 10% FBS + 10 FBS + P/S + Qx40–60 hours
    MCF7ECCRG repositoryDMEM + 10% FBS + P/S + insulin30–72 hours
    T47DECMiguel Beato’s lab (CRG)90% RPMI 1640 + 10 h.i. FBS + MEM + P/S + Qx + NaPyr30–40 hours
    FaduECSalvador Aznar-Benitah’s lab (IRB)MEM + 10%FBS + P/S + PyrNa30 hours
  • Table 2 List of antibodies used in this study.

    DB, dot blot; IF, immunofluorescence; WB, Western blot; HRP, horseradish peroxidase.

    HostSourceCatalog no.UseLot numberDilution
    Primary antibody
      NANOGRateBioscienceeBioMLC-51IFE04352-16331:200
      γ-H2AXMouseAbcamab22551WB/IF1:1000
      β-ActinMouseAbcamab8226WB1594771:10,000
      VinculinMouseSigmaV9131WB/DB018M4779V1:10,000
      AHCYRabbitMBLRN126PWWB/IF/ChIP0011:1000–500
      RPA32RatCell Signaling2208IF1:250
      H3RabbitAbcamab1791WB/DB8254441:5000–10,000
      H3K9me3RabbitAbcamab8898WBGR22415-11:2000
      IgGRabbitAbcamab172730ChIPGR262233-95 μg
    Secondary antibody
      HRP anti-mouse IgGGoatDakoA-4416WB200302731:2000
      HRP anti-rabbit IgGGoatDakoA-6667WB200426221:2000
      Anti-rat Alexa 488DonkeyMolecular ProbesA-21208IF18104711:500
      Anti-rabbit Alexa 555DonkeyMolecular ProbesA-21206IF18379221:500
  • Table 3 List of primers used in this study.

    Oligonucleotides (5′ to 3′)
    Map2k5_FGCAGGATCGTCCGACTGAG
    Map2k5_RTTGGTTCCGGAGTAACAGCG
    Rbl1_FGGACCTCGGACTCTAACGGA
    Rbl1_RTCTCTCACGTCCGTCCCC
    Hdac2_FCGTAAGACCGAGGGGTGAAC
    Hdac2_RGGGTAGTCACACACAGTCCG
    Rps20_FGGGCGTCTTTCCGGTATCTTT
    Rps20_RCCACTTACGGGTCGCTGTTT
    Rpl18_FTCGGTCCTCCCACATACCAT
    Rpl18_RCTATCCGGAACTGGCGTCTC
    Rpl4_FTAGAGGAGGGCGAAGGTTCA
    Rpl4_RGGCCAGAAAAGGTGCTAGGT
    Rpl17_FGCTCGGCTTCTACGGTGAG
    Rpl17_RCAGGCTTAGGCACAGAGCAG
    Spink2_FCATATCCCGACGCATAGCCT
    Spink2_RTGGGGTGGAGAGGTAGCTTG
    ChIP_neg_ctrl_FCAGTCACCCAGGAAAGGCAA
    ChIP_neg_ctrl_RAAGGTAGGGCAAGAAGTGCC
  • Table 4 List of sequencing runs.

    SampleTotal readsMapped
    reads
    Single/
    Paired
    Read
    length
    GSM3262022
    ChIPseq_Ahcy_Replicate1
    11737352377231344S50
    GSM3262023
    ChIPseq_Ahcy_Replicate2
    6512730349321533S50
    GSM3262024
    ChIPseq_IgG
    12820953686504098S50
    GSM3262025
    RNAseq_shC_R1_shControl
    7346687370314234S50
    GSM3262026
    RNAseq_shC_R2_shControl
    7108301468659269S50
    GSM3262027
    RNAseq_sh4_R1_shAhcy
    7175148868688907S50
    GSM3262028
    RNAseq_sh4_R2_shAhcy
    7993115876726955S50
    GSM3262029
    RNAseq_sh5_R1_shAhcy
    7117844768065093S50
    GSM3262030
    RNAseq_sh6_R1_shAhcy
    7204646468723751S50
    GSM3262031
    RNAseq_sh6_R2_shAhcy
    7209198869578603S50
    GSM3262032
    RNAseq_EdU_minus_R1
    3089460429693657S50
    GSM3262033
    RNAseq_EdU_minus_R2
    4712129045649660S50
    GSM3262034
    RNAseq_EdU_plus_R1
    4007573438383847S50
  • Table 5 List of available datasets used in this study.

    List of available datasets used in this study..

    Histone mark/DNA modification/proteinSample accession number
    H3K4me3GSM590112
    H3K27me3GSM590116
    H3K36me3GSM590120
    H3K27acGSM1355158
    5mCGSM1053460
    MycGSM286124
    Trim28GSM308532
    cMycGSM288356
    Dmap1GSM516405
    Cnot3GSM308533
    nMycGSM288357
    Tip60GSM516406
    Gcn5GSM516407
    cMycGSM286124
    E2f4GSM516408
    MaxGSM516404
    Rex1GSM286125
    ZfxGSM288352
    Zfp281GSM286123
    Sox2GSM286121
    Klf4GSM286122
    Klf4GSM288354
    Dax1GSM286119
    Stat3GSM686673
    Dax1GSM286119
    Stat3GSM288353
    Nac1GSM286120
    Sox2GSM288347
    NanogGSM288345
    NanogGSM1090230
    Ring1bGSM656523
    Ring1bGSM1003596
    Suz12GSM1019771
    Suz12GSM288360
    Ezh2GSM480161
    Ezh2GSM475259
    Ring1bGSM585229
    Ezh1GSM386202
    Suz12GSM480162

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/5/3/eaav2448/DC1

    Fig. S1. Chromatin capture from pluripotent ESCs by Dm-ChP.

    Fig. S2. Culture conditions for Dm-ChP are compatible with normal physiology.

    Fig. S3. Biological and pathologically relevant chromatin-associated proteins in ESCs.

    Fig. S4. Expression of key developmental genes during early mammalian development.

    Fig. S5. AHCY is recruited to the TSS of transcriptionally active genes.

    Fig. S6. Expression of pluripotency genes upon Ahcy knockdown.

    Fig. S7. Proteomic analysis of ribosomal protein encoded by AHCY targets.

    Fig. S8. Inhibition of AHCY reduces rate of protein synthesis.

    Fig. S9. Gating strategy for cell cycle and HPG incorporation analysis by FACS.

    Table S1. Principal methods developed to identify protein components of the chromatin.

    Table S2. Proteomic data.

    Table S3. ChIP-seq data.

    Table S4. RNA-seq data.

  • Supplementary Materials

    The PDF file includes:

    • Fig. S1. Chromatin capture from pluripotent ESCs by Dm-ChP.
    • Fig. S2. Culture conditions for Dm-ChP are compatible with normal physiology.
    • Fig. S3. Biological and pathologically relevant chromatin-associated proteins in ESCs.
    • Fig. S4. Expression of key developmental genes during early mammalian development.
    • Fig. S5. AHCY is recruited to the TSS of transcriptionally active genes.
    • Fig. S6. Expression of pluripotency genes upon Ahcy knockdown.
    • Fig. S7. Proteomic analysis of ribosomal protein encoded by AHCY targets.
    • Fig. S8. Inhibition of AHCY reduces rate of protein synthesis.
    • Fig. S9. Gating strategy for cell cycle and HPG incorporation analysis by FACS.

    Download PDF

    Other Supplementary Material for this manuscript includes the following:

    • Table S1 (.pdf format). Principal methods developed to identify protein components of the chromatin.
    • Table S2 (Microsoft Excel format). Proteomic data.
    • Table S3 (Microsoft Excel format). ChIP-seq data.
    • Table S4 (Microsoft Excel format). RNA-seq data.

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article