Research ArticleCANCER

Colorectal tumor-on-a-chip system: A 3D tool for precision onco-nanomedicine

See allHide authors and affiliations

Science Advances  22 May 2019:
Vol. 5, no. 5, eaaw1317
DOI: 10.1126/sciadv.aaw1317

Figures

  • Fig. 1 Design and characterization of the microfluidic chip.

    (A) Profilometer characterization: 3D map of the microfluidic chip. Representative image of quality control and characterization of the microfluidic chip features. The central chamber is 5 mm in diameter and 126 μm in depth, with a separate inlet and outlet for hydrogel injection. The two lateral channels, each 100 μm in width and 126 μm in depth, are not interconnected, opening up the possibility of perfusing two distinct solutions. (B) Schematic of chip design and zoom-in image of the concept of colorectal tumor-on-a-chip model: Round microfluidic central chamber in which HCT-116 cancer cells are embedded in Matrigel; HCoMECs are seeded in the side channels to form a 3D vessel-like assembly. (C) Establishment of a microvascular 3D microenvironment of colorectal tumor-on-a-chip: HCT-116 CRC cells embedded in Matrigel (in central chamber, stained in red) and HCoMECs (in lateral microchannels, stained in yellow) at day 1 (1D) and day 5 (5D) of culture. Endothelial cells start to invade the central chamber filled with Matrigel in response to VEGF presence. (D) Fluorescence microscopy image of microfluidic lateral channel mimicking prevascularization with HCoMECs after 5 days of culture [4′,6-diamidino-2-phenylindole (DAPI) blue, nuclei; phalloidin green, F-actin filaments]. Representative fluorescence microscopy close-up image of microchannel cross section showing endothelial cells aligning and creating an endothelialized lumen within the microchannel.

  • Fig. 2 Endothelial cell invasion.

    (A) Schematic representation of HCoMECs in the lateral channels invading the central chamber in response to the presence of VEGF mixed in the Matrigel. (B) Formation of endothelial sprouts in the microfluidic device: Representative bright-field images of the chip taken at determined time points were analyzed with ImageJ. (C) Quantification of endothelial invasion. Data are presented as means ± SD (n = 9). The asterisk (*) denotes statistical differences (P < 0.01).

  • Fig. 3 Schematic representation of fluorescent nanoparticle gradient formation.

    (A) Transmission electron microscopy image of individual CMCht/PAMAM dendrimer nanoparticle, representative image of chip connected to tubing perfusing the nanoparticle solution, and zoom-in confocal microscopy image confirming FITC-labeled CMCht/PAMAM dendrimer nanoparticles’ dispersion in Matrigel. (B) Panel of fluorescence microscopy images of FITC-labeled nanoparticle gradient up to 12 hours. (C) Quantification of fluorescence: Intensity [in arbitrary units (a.u.)] versus distance (in micrometers) across the chip up to 12 hours [measurements according to the direction of the green arrow indicated in (B)]. (D) 3D projection of FITC-labeled nanoparticle gradient according to fluorescence intensity.

  • Fig. 4 GEM drug effect on colorectal tumor model.

    (A) Release profile of GEM: Cumulative release (in hours) of GEM at pH 7.4 in phosphate-buffered saline (PBS), at 37°C and stirred at 60 rpm, determined by ultraviolet (UV) spectrophotometer set to 275 nm. The results are expressed as means ± SD (n = 6). (B) Schematic representation of experimental setup [perfusion of culture medium through one inlet and one outlet and of culture medium supplemented with GEM-loaded dendrimer nanoparticles (0.5 mg/ml) through the other inlet and outlet]; the areas defined for cell death quantification are delimited by dashed lines, and each ring is assigned D1 to D3 and M1 to M3. (C) Representative images of fluorescence microscopy images of live/dead assay performed on microfluidic chip at days 1 and 5. (D) Quantification of cell death, represented as percentage, based on the microscopy data. Data are presented as means ± SD (n = 3). The asterisk (*) denotes statistical differences (P < 0.05). Scale bars, 1000 μm. NP, nanoparticle; CTRL, control.

  • Fig. 5 Gene expression analysis and immunocytochemistry on a chip.

    (A) Representation of hydrogel retrieval containing HCT-116 cells from the chip for gene expression analysis. (B) Gene expression of Ki-67, Casp-3, and MMP-1, in the absence (control) and presence of GEM, at days 1 and 5. The values for controls are represented by the dashed line. The asterisk (*) indicates significant differences when comparing the same condition at two different time points. The hash key (#) indicates significant differences when comparing to controls at the same time point. Data represent mean values of three independent experiments ± SD. RPS27A, ribosomal protein S27A. (C) Immunohistochemistry: In the center, a representative image of the entire chip is depicted. The lateral images represent the zoom in at the cell level showing the immunocytochemistry Ki-67 staining after 5 days in culture [panels showing DAPI nuclei staining (blue), Ki-67 staining (green), F-actin staining (red), and merged image in colors].

Tables

  • Table 1 Primer list for the studied genes.

    Oligo nameSequence 5′ to 3′
    Casp-3 (human) FGAAATTGTGGAATTGATGCGTGA
    Casp-3 (human) RCTACAACGATCCCCTCTGAAAAA
    MMP-1 (human) FGGGGCTTTGATGTACCCTAGC
    MMP-1 (human) RTGTCACACGCTTTTGGGGTTT
    Ki-67 (human) FGCTGGCTCCTGTTCACGTA
    Ki-67 (human) RCTGGGCTACACTGAGCACC
    RPS27A (human) FGCTTGCCAGCAAAGATCAGT
    RPS27A (human) RGAGGTTGAACCCTCGGATAC

Stay Connected to Science Advances

Navigate This Article