Research ArticleHEALTH AND MEDICINE

Targeted pathological collagen delivery of sustained-release rapamycin to prevent heterotopic ossification

See allHide authors and affiliations

Science Advances  29 Apr 2020:
Vol. 6, no. 18, eaay9526
DOI: 10.1126/sciadv.aay9526
  • Fig. 1 The mTOR signaling pathway is required in tendon HO.

    (A and B) Micro-CT imaging and quantitative analysis of the Achilles tendon from WT and mTOR knockout (mTOR-TKO) mice. n = 10. Scale bar, 2 mm. (C to F) HE, Masson, and SO staining and histological score evaluation of WT and mTOR-TKO mice. n = 10. Scale bar, 50 μm. (G and H) ALP staining and positive rate of cells cultured in an osteogenic medium for 7 days. n = 3. Scale bars, 100 μm. (I and J) ARS staining and optical density (OD) value of cells cultured in the osteogenic medium for 14 days. n = 3. Scale bar, 200 μm. (K) Light microscopy of cells cultured in the chondrogenic medium for 3 days. BV, bone volume.

  • Fig. 2 RNA-seq analysis of tendon between WT and mTOR-knockout (mTOR-TKO) mice.

    (A) Volcano plot of gene expression (mTOR-TKO versus WT; fold change, ≥2; q value < 0.05). (B) Heat map of differentiated expression genes. (C) GO analysis of differentially expressed genes. (D and E) GSEA of the genes associated with mTOR signaling and BMP signaling. NES, normalized enrichment score; FDR, false discovery rate; KO, knockout.

  • Fig. 3 RAPA inhibited osteogenesis and chondrogenesis of TSPCs induced by IL-1β.

    (A) Cell proliferation of TSPCs when cultured with different concentrations of RAPA. (B) The protein expression of mTOR signaling pathway, including p-mTOR, mTOR, p-S6, S6, and the reference protein α-tubulin. (C and D) Alcian blue and SO staining of TSPCs cultured in the chondrogenic medium for 14 days. Scale bars, 50 μm. (E and F) ALP and ARS staining of TSPCs cultured in the osteogenic medium for 7 and 14 days, respectively. Scale bars, 50 and 200 μm, respectively. (G) Optical density (blue) of Alcian blue staining. n = 3. ns, not significant. (H) Optical density (red) of SO staining. n = 3. (I) Positive rate of ALP staining. n = 3. (J) Optical density value of ARS staining. n = 3.

  • Fig. 4 Characterization of CHP-PLGA nanoparticles.

    (A and B) TEM and SEM images of PLGA and CHP-PGLA nanoparticles. Scale bars, 1 μm. (C) Zeta potential of PLGA and CHP-PLGA nanoparticles. n = 4. (D) Size distribution of PLGA and CHP-PLGA nanoparticles. (E and F) CHP density at various feeding concentrations and different times. n = 4. (G) Drug release from PLGA and CHP-PLGA nanoparticles over the course of 10 days. n = 4. (H) TEM of CHP-PLGA binding to intact and injured collagen. (I) SEM of CHP-PLGA binding to intact and injured tendon.

  • Fig. 5 In vivo assessment of pathological tendon-affinity ability of CHP-PLGA nanoparticles in a mouse model of tendon HO.

    (A) In vivo fluorescence images of injured Achilles tendon after subcutaneous injection of nanoparticles. Scale bars, 1 cm. (B and C) Total radiant efficiency and percentage of signal preservation of nanoparticles at different time points. n = 5.

  • Fig. 6 In vivo assessment of pathological tendon protection ability of CHP-PLGA-RAPA nanoparticles in a mouse model of tendon HO.

    (A) Animal experiment design. (B and C) micro-CT images of the Achilles tendon at 6 weeks after HO modeling and quantitative analysis. n = 10. Scale bar, 2 mm. (D to G) HE, Masson, and SO staining and histological score evaluation of the Achilles tendon at 6 weeks. n = 10. Scale bars, 50 μm.

  • Genes5′-3′Sequence
    Mouse
    Scx
    Forward
    Reverse
    CCTTCTGCCTCAGCAACCAG
    GGTCCAAAGTGGGGCTCTCCGTGACT
    Mouse
    Mkx
    Forward
    Reverse
    CCCCGGACATCGGATCTACTA
    CTCTTAGGATGAGGATTTAGGTA
    Mouse
    Tnmd
    Forward
    Reverse
    GGGTGGTCCCGCAAGTGAAGGTG
    GCCTCGACGACAGTAAATACAACAGT
    Mouse
    Dcn
    Forward
    Reverse
    AGACTCACAGCCGAGTAGGA
    ACATTCGCATCTCAGACACC
    Mouse
    Fmod
    Forward
    Reverse
    CAATGTCTACACCGTCCCTGA
    AGAAGGCTGCTGGAGTTGAAG
    Mouse
    Col1α1
    Forward
    Reverse
    AACCCGAGGTATGCTTGATCT
    CCAGTTCTTCATTGCATTGC
    Mouse
    Col3α1
    Forward
    Reverse
    GCCTCCCAGAACATTACATAC
    CAATGTCATAGGGTGCGATA
    Mouse
    Col14α1
    Forward
    Reverse
    CGTGCTCTGCTTATGGCGTTG
    ACGTGACAGCATTTGGTAAGTG
    Mouse
    Egr1
    Forward
    Reverse
    CAGCGCCTTCAATCCTCAAG
    GCGATGTCAGAAAAGGACTCTGT
    Mouse
    Fn1
    Forward
    Reverse
    GCCACACCTACAACCAGTATACA
    GGTGGGGCTGGAAAGATTACTC
    Mouse
    Gapdh
    Forward
    Reverse
    ATACGGCTACAGCAACAGGG
    TGTGAGGGAGATGCTCAGTG

Supplementary Materials

  • Supplementary Materials

    Targeted pathological collagen delivery of sustained-release rapamycin to prevent heterotopic ossification

    Yangwu Chen, Weiliang Shen, Chenqi Tang, Jiayun Huang, Chunmei Fan, Zi Yin, Yejun Hu, Weishan Chen, Hongwei Ouyang, Yiting Zhou, Zhengwei Mao, Xiao Chen

    Download Supplement

    This PDF file includes:

    • Figs. S1 to S9

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article