Research ArticleDISEASES AND DISORDERS

Epidermal autonomous VEGFA/Flt1/Nrp1 functions mediate psoriasis-like disease

See allHide authors and affiliations

Science Advances  08 Jan 2020:
Vol. 6, no. 2, eaax5849
DOI: 10.1126/sciadv.aax5849
  • Fig. 1 Flt1 expression by keratinocytes is essential for Vegfa-induced psoriasis.

    (A) Strategy to constitutively activate Vegfa and inhibit Flt1. (B) Vegfa and Flt1 mRNA expression by qRT-PCR on FACS-isolated keratinocytes (n = 3) (means ± SEM, Mann-Whitney). (C) Flt1 expression assessed by Western blot on FACS-isolated basal keratinocytes. (D) Flt1 protein expression (n = 3) (means ± SEM, Mann-Whitney). (E) Naso-oral region, ear, and tail. (F) Hematoxylin and eosin (H&E) on tail skin. Scale bars, 50 μm. (G) Epidermal tail thickness measured microscopically (n = 10) (means ± SEM, Student’s t test). (H) K14/EdU staining. Scale bars, 50 μm. (I) Percentage of EdU-positive basal cells (BCs) in interfollicular epidermis (IFE) [n = 398 (Ctrl), n = 436 (K14-Vegfa), n = 422 (K14-Vegfa/Flt1 cKO) total BCs, n = 10 mice] (mean ± SEM, Student’s t test). (J) K14/CD45 staining. Scale bars, 50 μm. (K) Density of CD45-positive cells in dermal IFE area (represents the dermal area just beneath the IFE) of 300,565 μm2 (Ctrl), 289,678 μm2 (K14-Vegfa), and 278,767 μm2 (K14-Vegfa/Flt1 cKO); n = 10 mice. Number of CD45-positive cells per 10,000 μm2 (means ± SEM, Student’s t test). (L) K14/CD31 staining. Scale bars, 50 μm. (M) Number of CD31-positive cells (microvascular density) calculated in dermal IFE area of 324,567 μm2 (Ctrl), 345,234 μm2 (K14-Vegfa), and 342,356 μm2 (K14-Vegfa/Flt1 cKO); n = 10 mice. Number of CD31-positive cells per 10,000 μm2 (means ± SEM, Student’s t test). Photo credit: Benhadou Farida, Laboratory of Stem Cells and Cancer.

  • Fig. 2 Cell autonomous function of Nrp1 in the epidermis is critical for Vegfa-induced psoriasis.

    (A) Strategy to constitutively activate Vegfa and delete Nrp1 expression in epidermis. (B) Vegfa and Nrp1 mRNA expression by qRT-PCR on FACS-isolated keratinocytes (n = 3) (means ± SEM, Mann-Whitney test). (C) Nrp1 expression assessed by Western blot performed on FACS-isolated basal keratinocytes. (D) Nrp1 protein expression (n = 3) (means ± SEM, Mann-Whitney test). (E) Naso-oral region, ear, and tail. (F) H&E on tail skin. Scale bars, 50 μm. (G) Epidermal tail thickness measured microscopically (n = 10) (mean ± SEM, Student’s t test). (H) K14/EdU staining. Scale bars, 50 μm. (I) Percentage of EdU-positive BCs [n = 507 (Ctrl), n = 487 (K14-Vegfa), n = 490 (K14-Vegfa/Nrp1 cKO) total BCs; n = 10 mice] (means ± SEM, Student’s t test). (J) K14/CD45 staining. Scale bars, 50 μm. (K) Density of CD45-positive cells in the dermal IFE area of 344,965 μm2 (Ctrl), 449,687 μm2 (K14-Vegfa), and 423,876 μm2 (K14-Vegfa/Nrp1 cKO); n = 10 mice. CD45-positive cells per 10,000 μm2 (means ± SEM, Student’s t test). (L) K14/CD31 staining. Scale bars, 50 μm. (M) Number of CD31-positive cells calculated in a dermal IFE area of 409,560 μm2 (Ctrl), 432,890 μm2 (K14-Vegfa), and 428,532 μm2 (K14-Vegfa/Nrp1 cKO); n = 10 mice. Number of CD31-positive cells per 10000 μm2 (means ± SEM, Student’s t test). Photo credit: Benhadou Farida, Laboratory of Stem Cells and Cancer.

  • Fig. 3 Function-blocking anti-Nrp1 antibodies improve Vegfa-induced psoriasis.

    (A to C) Naso-oral region, ear, and tail, (D) H&E on tail skin. Scale bars, 50 μm. (E) Measures of epidermal thickness (n = 3) (means ± SEM, Mann-Whitney). (F) K14/EdU staining. Scale bars, 50 μm. (G) Percentage of EdU-positive BCs [n = 387 (isotype, day 0), n = 354 (isotype, day 15), n = 424 (Nrp1b AB, day 0), n = 409 (Nrp1b AB, day 15), n = 391 (Nrp1a AB, day 0), n = 421 (Nrp1a AB, day 15) total BCs, n = 3] (means ± SEM, Mann-Whitney). (H) K14/CD45 staining. Scale bars, 50 μm. (I) Density of CD45-positive cells in the dermal IFE area of 254,342 μm2 (isotype, day 0), 298,567 μm2 (isotype, day 15), 267,890 μm2 (Nrp1b AB, day 0), 287,908 μm2 (Nrp1b AB, day 15), 257,560 μm2 (Nrp1a AB, day 0), 294,901 μm2 (Nrp1a AB, day 15); n = 10. Number of CD45-positive cells per 10,000 μm2 (means ± SEM, Mann-Whitney). (J) K14/CD31 staining. Scale bar, 50 μm. (K) Microvascular density in dermal IFE area of 267,980 μm2 (isotype, day 0), 234,589 μm2 (isotype, day 15), 222,370 μm2 (Nrp1b AB, day 0), 223,456 μm2 (Nrp1b AB, day 15), 200,154 μm2 (Nrp1a AB, day 0), and 212,980 μm2 (Nrp1a AB at day 15). Number of CD31-positive cells per 10,000 μm2 (means ± SEM, Mann-Whitney). Photo credit: Benhadou Farida, Laboratory of Stem Cells and Cancer.

  • Fig. 4 Transcriptional landscape associated with Nrp1/Flt1/Vegfa signaling in psoriasis.

    (A) Pie chart showing the percentage of total up-regulated genes in K14-Vegfa and depending either on common Nrp1/Flt1 (=Nrp1/Flt1 dependent) or specifically on Nrp1 (=Nrp1 dependent) or Flt1 (Flt1 dependent) expression. Genes with unchanged expression after Nrp1or Flt1 epidermal ablation were also represented (=Nrp1/Flt1-independent up genes). (B) GO analysis of up-regulated genes in Vegfa overexpression in an Nrp1- and Flt1-dependent manner. (C) mRNA relative expression of up-regulated genes by RNA-seq in Vegfa overexpression in FACS-isolated basal keratinocytes (n = 2) (means ± SEM). (D) Pie chart showing the percentage of total down-regulated genes in K14-Vegfa and depending either on common Nrp1/Flt1 expression (=Nrp1/Flt1 dependent) or specifically on Nrp1 (=Nrp1 dependent) or Flt1 (Flt1 dependent) expression. Genes with unchanged expression after Nrp1 or Flt1 epidermal ablation were also represented (=Nrp1/Flt1-independent down genes). (E) GO analysis of down-regulated genes in Vegfa overexpression in an Nrp1- and Flt1-dependent manner. (F) mRNA relative expression of down-regulated genes by RNA-seq in Vegfa-overexpressing mice and depending on Nrp1 or Flt1 expression in FACS-isolated keratinocytes (n = 2) (means ± SEM).

  • Fig. 5 Chromatin landscape associated with Nrp1/Flt1/Vegfa signaling in psoriasis.

    (A) Percentage of total up-regulated peaks in K14-Vegfa and depending either on Nrp1/Flt1 (=Nrp1/Flt1 dependent) or specifically on Nrp1 (=Nrp1 dependent) or Flt1 (Flt1 dependent) or independent of Nrp1 or Flt1 expression (=Nrp1/Flt1 independent). (B) Percentage of down-regulated peaks and their distribution in the different categories. (C) Enriched TF motifs found in the peaks that were up- or down-regulated (D) in an Nrp1/Flt1-dependent manner. P value of enrichment of the motif in peaks compared with background and percentage of peaks containing the motif. (E) Percentage of total up-regulated peaks in K14-Vegfa overlapping with up-regulated genes and depending either on Nrp1/Flt1 expression (=Nrp1/Flt1 dependent) or specifically on Nrp1 (=Nrp1 dependent) or Flt1 (Flt1 dependent) or independent of Nrp1 or Flt1 expression (=Flt1/Nrp1 independent). (F) mRNA expression of up-regulated genes by RNA-seq in FACS-isolated basal keratinocytes (n = 2) (means ± SEM). (G) Enriched transcription TF motifs in the peaks up-regulated in an Nrp1/Flt1-dependent manner. (H) Percentage of total down-regulated genes and their distribution in the different categories. (I) mRNA expression of down-regulated genes by RNA-seq in FACS-isolated basal keratinocytes (n = 2) (means ± SEM). (J) Enriched TF motifs in the peaks down-regulated in an Nrp1/Flt1-dependent manner.

  • Fig. 6 Fosl1 acts downstream of Vegfa/Flt1 signaling in the regulation of chromatin remodeling and transcriptional change associated with psoriasis.

    (A) mRNA expression of AP-1 members by RNA-seq in FACS-isolated basal keratinocytes (n = 2) (means ± SEM). (B) IHC (immunohistochemistry) of Fosl1 nuclear staining in tail epidermis. Scale bars, 10 μm. (C) IHC of Folsl1 in ear epidermis. Scale bars, 10 μm. (D) Fosl1 expression assessed by Western blot on primary cultured keratinocytes from K14-Vegfa after transduction with control (sh Ctrl) or Fosl1-specific shRNA (sh Fosl1).(E) Protein expression of Fosl1 (n = 3). Histogram represents means ± SEM. (F) Vegfa and Fosl1 mRNA expression measured par qRT-PCR on primary cultured keratinocytes from K14-Vegfa transduced with sh Ctrl or sh Fols1 (n = 3) (means ± SEM, Mann-Whitney). (G) Relative chromatin accessibility measured by ATAC qPCR of chromatin regions presenting AP-1 binding sites in the regulatory regions of up- or down-regulated genes (H) in primary cultured keratinocytes from K14-Vegfa transduced with sh Ctrl or sh Fosl1 (n = 3). Primers were designed around the control region (c) and peak region (p) (means ± SEM, Mann-Whitney). (I) mRNA expression by qRT-PCR of up- or down-regulated genes (J) presenting AP-1 binding sites in their regulatory regions in primary cultured keratinocytes from K14-Vegfa transduced with sh Ctrl or sh Fosl1 (n = 3) (means ± SEM, Mann-Whitney test).

  • Table 1 List of qPCR primers for mouse.

    Gene nameForward (5′-3′)Reverse (5′-3′)
    Nrp1CATCTCCCGGTTACCCTCATTCTTGCGGCCGCCTTCATTCTC
    VegfaTGGGCTCTTCTCGCTCCGTAGTAGGCCGCCTCACCCGTCCAT
    Fosl1CAAGTGGTTCAGCCCAAGAACACAAGGTGGAACTTCTGCTG
    Flt1AAAGGCTGAGCATCACTCCCCTACAGGTGTAGAGGCCCGT
    Flk1TGTGCTTCTTGTCTCTGGCGCCTTCAAAAGCCTTGACCTCG
    Art3CTGGGAGCGCAGTTCTAATGGCAGGTATTCGTCGTCAAACGC
    Nlrc5AACCAATGTCTGTGCCCTGTCTGGCTGCTCAGAAGTGGTA
    Alox5apCTCATTTTGCGGTCGCTATCCATCCATGCCATTGTAGCCGTA
    Ikzf2GAGCCGTGAGGATGAGATCAGCTCCCTCGCCTTGAAGGTC
    Tlr4TCGACATGGATCAGTTTATGCGCCCTGGTACTGTTGTAGATGGA
    Ism1AGAGCAGCCAGAGTATGATTCCGCCGCTGTCCTGAAAGTATCT
    Mmp13CTTCTTCTTGTTGAGCTGGACTCCTGTGGAGGTCACTGTAGACT
    Angptl7AGAGGCCCCAGCTTATTCCAACAGGGGTATAGCTTCCAAGGC
    Tgfb2TCGACATGGATCAGTTTATGCGCCCTGGTACTGTTGTAGATGGA
    Tnfrsf19TTCTGTGGGGGACACGATGAGAAAATTCAGCGCAGATGGAA
    B actinCCAGCCTTCCTTCTTGGGTATTGTTGGCATAGAGGTCTTTACGG
  • Table 2 List of ATAC qPCR primers.

    Control region
    Gene nameForward (5′-3′)Reverse (5′-3′)
    Nlrc5AAGGAACGGAGACAGAAGCGAAAGGAGCAAGACCACCCTG
    Alox5apGTACAGGGGCAGGTGTTTCAAAGTCTTCCTTGTGCCCTGG
    Ikzf2CCTCAGCTTCCACACCTCTGCTCCTCCTGCATCAGTTCTTGA
    Tlr4TTCTTGGGAAACACTTGGTGAATGCTGAGAGGAAGATTCGCTT
    Ism1GTACAACGCTGGGAGAGTTCCATCTGAGCCCAACCTGGATGA
    Mmp13AAGCTGGCTCAGTCCTGTTTTGTAGGGGCAGAGGAAGGGA
    Angptl7AGGAGGCTAGTCCGATAGGGAAACCGCAGTACCAGTGCAA
    Tgfb2GCAACTGCCATTTTCCTGGGCGGATGGGACAGCCATCCTT
    Tnfrsf19CCAATCTTCAGGGCAGGGTTAGAACTGTTGCCAACCCACT
    Peak region
    Art3TCCCAGGGAAACCTCAAAGGGCTTTCACCTTCCAGTGGCT
    Nlrc5GGTTGGGGGTGGGGGTATATGTGAATTATCTAAGGACATGGGC
    Alox5apTAGACTCAGGCCAAACCCCTGCCAGTGTGCTATCAAGCCT
    Ikzf2TTCCTGACTAGCCCCATCCACAGGACCTGGGTTTTAGCCT
    Tlr4ACTCAGACCTGATCCTGCTTGAATGTCAGCCTTCTCCCCAA
    Ism1TTCTGGGTGTGGGTGGTCTAGGGAACTGAAGCCTTCTGCC
    Mmp13GAGGAGGCATGGGTATGGTCAGAAAGCAGTTGGTTGGCCC
    Angptl7GGGAGCCTCCAATTTCTTCCTGCCATTGATGGGATTGTGTTTTTGT
    Tgfb2AGAGTATGGCTGGCTCTCCATGGGTCACAATGAGATGGGC
    Tnfrsf19AAACGAATGTTGCTGCACGATGTGCGACAGATTGACCCTG
  • Table 3 Statistical analysis performed for each experiment.

    FiguresNormal distributionEquality of variancesComparison tests
    YesNoYesNoStudent’s t testMann-Whitney
    1 (B and D)
    1 (G, I, K, and M)
    2 (B and D)
    2 (G, I, K, and M)
    3 (E, I, J, and K)
    6 (F to K)
    S1 (D, F, H, and J)
    S1K
    S2B
    S2D
    S3 (F to H)
    S4 (D to F and I)
    S5 (C to F)
    S6C

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/2/eaax5849/DC1

    Fig. S1. Vegfa overexpression in the epidermis mediates psoriasis-like disease.

    Fig. S2. Composition of immune infiltrate.

    Fig. S3. Nrp1 and Flt1 are genetically linked.

    Fig. S4. Epidermal autonomous expression of Flt1 is essential for psoriasis development induced by c-Jun/JunB deletion.

    Fig. S5. Genes presenting AP-1 motifs in the chromatin regions remodeled by Vegfa/Flt1 signaling.

    Fig. S6. Phosphorylation assay.

    Fig. S7. Model of the epidermal autonomous VEGF/Flt1/Nrp1 signaling in psoriasis-like disease.

    Table S1. Biological functions of up-regulated genes in an Nrp1/Flt1-dependent manner.

    Table S2. Biological function of down-regulated genes in an Nrp1/Flt1-dependent manner.

    Table S3. Biological function of genes associated with ATAC peaks in an Nrp1/Flt1-dependent manner.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. Vegfa overexpression in the epidermis mediates psoriasis-like disease.
    • Fig. S2. Composition of immune infiltrate.
    • Fig. S3. Nrp1 and Flt1 are genetically linked.
    • Fig. S4. Epidermal autonomous expression of Flt1 is essential for psoriasis development induced by c-Jun/JunB deletion.
    • Fig. S5. Genes presenting AP-1 motifs in the chromatin regions remodeled by Vegfa/Flt1 signaling.
    • Fig. S6. Phosphorylation assay.
    • Fig. S7. Model of the epidermal autonomous VEGF/Flt1/Nrp1 signaling in psoriasis-like disease.
    • Table S1. Biological functions of up-regulated genes in an Nrp1/Flt1-dependent manner.
    • Table S2. Biological function of down-regulated genes in an Nrp1/Flt1-dependent manner.
    • Table S3. Biological function of genes associated with ATAC peaks in an Nrp1/Flt1-dependent manner.

    Download PDF

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article