Research ArticleNEUROPHYSIOLOGY

Chromatin-based reprogramming of a courtship regulator by concurrent pheromone perception and hormone signaling

See allHide authors and affiliations

Science Advances  22 May 2020:
Vol. 6, no. 21, eaba6913
DOI: 10.1126/sciadv.aba6913
  • Fig. 1 Social experience increases open chromatin marks around fru P1 promoter.

    Antennal ChIP qPCR to measure association of open chromatin marks around fru P1 promoter using anti-RNA polymerase II, anti-H3K27ac, anti-H3K9ac, and anti-p300 antibodies from adult male antennal samples that are either GH (black) or SH (red) (A to C). y axis shows enrichment relative to no antibody control. Social isolation decreases enrichment of either mark in SH male antennae at all time points. (A) Time course of RNA polymerase II (left) and H3K27ac (right) association with fru P1 at days 1, 3, 5, and 7 after eclosion. (B) Enrichment of RNA polymerase II around fru P1 in 5-day-old GH and SH Canton S versus w1118 males. Enrichment of RNA polymerase II (C), p300 (C′), H3K27ac (C″), and H3K9ac (C‴) open chromatin marks around fru P1 are shown for GH and SH w1118, Or47b, and Or67d mutants. (D to G) Enrichment of active chromatin marks (RNA polymerase II, p300, H3K27ac, and H3K9ac) upstream of genes expressed in the antenna (Or82a and Or47b) and not expressed in the antennae (Gr5a) in different housing conditions. *P < 0.05; **P < 0.005; ***P < 0.001; n.s., not significant.

  • Fig. 2 Effects of social experience on fru expression.

    (A) Confocal images of fruP1GAL4-driven UAS-GFP in the antennae from GH and SH males of different ages. (B) Quantification of fruP1GAL4-driven UAS-GFP expression in Or47b and Or67d ORNs from (A). x axis shows integrated GFP density, and y axis represents the percent ORNs. (C) Average of the data points from (B). (D) qRT-PCR for fruM (left) and fruC (right) from antennal samples of w1118 males that are either SH or GH. *P < 0.05; **P < 0.005; ***P < 0.001.

  • Fig. 3 Pheromone exposure and regrouping rescues chromatin-based effects around fru P1.

    fruP1GAL4-driven UAS-GFP expression in male antennae from GH (top left) and SH (top right). Lower panels show fruP1GAL4-driven UAS-GFP expression in SH males exposed to Or47b ligand PA between 0 to 5 or 3 to 5 days after eclosion (A) and 0 to 7 or 3 to 7 days after eclosion (D). Quantification of integrated GFP density from Or47b ORNs (B) and Or67d ORNs (C) in response to group housing, single housing, and 0 to 5 or 3 to 5 days of exposure of SH males to solvent or PA. Quantification of integrated GFP density from Or47b ORNs (E) and Or67d ORNs (F) in response to group housing, single housing, and 2 to 7 or 3 to 7 days of exposure of SH males to solvent or PA. (G) H3K27ac enrichment around fru P1 in w1118 male antennae socially isolated and then regrouped for a duration of 5 days (1 to 5, 3 to 7, and 5 to 9 days after eclosion) compared to SH male antennae. (H) H3K27ac enrichment around fru P1 in w1118 male antennae socially isolated and then regrouped for a duration of 7 days (1 to 7, 3 to 9, and 5 to 11 days after eclosion) compared to SH male antennae. *P < 0.05; **P < 0.005; ***P < 0.001; ****P < 0.0001; n.s., not significant.

  • Fig. 4 Calcium signaling and p300 function in Or47b neurons facilitates active chromatin around fru P1.

    Enrichment of RNA polymerase II (A), p300 (B), H3K27ac (C), and H3K9ac (D) around fru P1 in GH male antennae in Or47b-GAL4, UAS-CaMKI RNAi, UAS-nej (p300) RNAi, Or47b-GAL4 UAS-CaMKI RNAi, and Or47b-GAL4 UAS-nej (p300) RNAi. Multiple UAS-RNAi lines were used for each gene indicated by the chromosome and stock name. **P < 0.005; ****P < 0.0001; n.s., not significant.

  • Fig. 5 JH signaling recruits transcriptional machinery and facilitates open chromatin at fru P1.

    (A) fruP1GAL4-driven UAS-GFP expression in GH male antennae in gce-RNAi and met-RNAi knockdowns, as well as met1 mutants. UAS-RNAi expression is driven by fruP1GAL4. (B) Quantification of GFP intensity from fruP1GAL4-driven 40XUAS-CD8GFP expression in Or47b and Or67d neurons from (A). (C) Enrichment of RNA polymerase II, p300, and H3K27ac at fru P1 in GH male antennae with genotypes UAS-met RNAi, UAS-gce RNAi, Or47b-GAL4 UAS-met RNAi, and Or47b-GAL4 UAS-gce RNAi. (D) fruP1GAL4-driven 40XUAS-CD8GFP expression in GH male antennae in gce-RNAi and met-RNAi knockdowns raised at 28° or 22°C to vary knockdown efficiency. The flies are either raised at 28°C for 7 days or transferred to 22°C at day 1, 2, or 3 after eclosion before GFP analysis on day 7. RT, room temperature; Wt, wild type. (E and F) Quantification of integrated GFP density of antennae in (D). ****P < 0.0001; n.s., not significant.

  • Fig. 6 JH receptor binds upstream of fru P1 and primes it for chromatin-based regulation with social experience.

    (A) Enrichment of Gce at fru P1 in 7-day-old GH male antennae with genotypes Or47b-GAL4, UAS-gce RNAi, and Or47b-GAL4 UAS-gce RNAi. The time course of Gce association with fru P1 (B) and E-box upstream of fru P1 (C) in GH (black) or socially isolated (red) male antennae is shown. The x axis shows days after eclosion, and the y axis is enrichment relative to input. The enrichment of Gce at fru P1 (D) or E-box (E) in GH male antennae with genotypes UAS-nj(p300)RNAi, UAS-CaMKI RNAi, Or47b-GAL4 UAS-nj(p300)RNAi, and Or47b-GAL4 UAS-CaMKI RNAi is shown. (F and G) Enrichment of H3K27me3 and H3K27me2 at fru P1 in GH or socially isolated male antennae. (H and I) Enrichment of H3K27me3 and H3K27me2 at fru P1 in GH male antennae with genotypes UAS-met RNAi, UAS-gce RNAi, Or47b-GAL4 UAS-met RNAi, and Or47b-GAL4 UAS-gce RNAi. (J) A model showing coincidence detection of hormone and pheromone signals by fru promoter. The presence of both social experience through pheromones and JH signaling leads to the assembly of JH receptors, activated p300, and RNA polymerase II and increases the association of active chromatin marks H3K29ac and H3K9ac at the fru P1. In the absence of social experience, p300 activation is inhibited, and JH receptor complexes accumulate at the fru P1 promoter. This leads to an increase in the association of H3K27me2, which interferes with non–cell type–specific activation of fru P1. In the absence of JH signaling, p300 and RNA polymerase II association decreases, and this leads to an increase in repressive chromatin marks such as H3K27me3. *P < 0.05; **P < 0.005; ***P < 0.001; ****P < 0.0001; n.s., not significant.

  • Table 1 Primer list.

    F, forward; R, reverse.

    Primer nameSequence
    ChIP qPCR primers
    FruM(−488)-ChIP FCAGGAGCTGTTACCATTTCAC
    FruM(−488)-ChIP RCCTTTACAGTGCCCGTTTAC
    FruM(+37)-ChIP FAAATCAGCAGCCGACATAC
    FruM(+37)-ChIP RTTTACAGCGCTCTAGCATTT
    FruM(+1224)-ChIP FAGTTGGCTGAGCACAATTC
    FruM(+1224)-ChIP RACACGGATTAGCCAGTTT
    Or82a(+109)-ChIP FGCTCTGACGTTGGCATAAC
    Or82a(+109)-ChIP RGCAGTTGAAACAGCCTACC
    Gr5a(−109)-ChIP FAATGCGACAGCTGAAAGG
    Gr5a(−109)-ChIP RTCATGGGATTCTAACGATTTGG
    Or47b(+147)-ChIP FCTTTCTGAGGTGAATCTG
    Or47b(+147)-Chip RCTTCTTGTTGGGATACTG
    Kr-h1-ChIP F (+10)CGTGACGTTCTCCGAATTT
    Kr-h1-ChIP R (+135)ACGAGATCGATTGGTAGGT
    E-box-ChIP F (−7774)GACGCATAAACGTCTTCCA
    E-box-ChIP R (−7641)CTCAGCTGCATCTCATTCTC
    qRT-PCR primers
    Or47b_qPCR FCAAATCTCAGCCTTCTGCGG
    Or47b_qPCR RGATACTGGCACAGCAAACTCA
    Gal4_qPCR FTTATGCCCAGGGATGCTCTT
    Gal4_qPCR RCGTCGCCAAAGAACCCATTA
    GFP_qPCR FATGGAAGCGTTCAATTAGCAGA
    GFP_qPCR RAAAGGGCAGATTGTGTGGAC
    fruC_qPCR FCAAATTTGACCGGCGTGCTAACCT
    fruC_qPCR RAGTCGGAGCGGTAGTTCAGATTGT
    fruM_qPCR FCCCGCATCCCCTAGGTACAA
    fruM_qPCR RGACTGTTTCGCCCTCGCAGG
    ACT5C_qPCR FGGCGCAGAGCAAGCGTGGTA
    ACT5C_qPCR RGGGTGCCACACGCAGCTCAT
    RPL13A_qPCR FGCGAGGAGCTGAACCTCTC
    RPL13A_qPCR RGGAAGTGGAATGGACCACGG
    RpLP0_qPCR FGTGCCCATCCTGAAGCCTG
    RpLP0_qPCR RCCTGGTTGACAATCAGACCGT
    TBP_qPCR FTAAGCCCCAACTTCTCGATTCC
    TBP_qPCR RGCCAAAGAGACCTGATCCCC

Supplementary Materials

  • Supplementary Materials

    Chromatin-based reprogramming of a courtship regulator by concurrent pheromone perception and hormone signaling

    Songhui Zhao, Bryson Deanhardt, George Thomas Barlow, Paulina Guerra Schleske, Anthony M. Rossi, Pelin C. Volkan

    Download Supplement

    This PDF file includes:

    • Figs. S1 to S4

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article