Research ArticleNEUROPHYSIOLOGY

Mfsd2a and Spns2 are essential for sphingosine-1-phosphate transport in the formation and maintenance of the blood-brain barrier

See allHide authors and affiliations

Science Advances  29 May 2020:
Vol. 6, no. 22, eaay8627
DOI: 10.1126/sciadv.aay8627
  • Fig. 1 Mfsd2a deficiency causes insufficient transport of S1P in the brain parenchyma, resulting in BBB breakdown.

    The S1P concentration in the ECM in the brain is reduced in Mfsd2a−/− mice. (A) Strategy used for FTY720 injection and Evans blue examination of the BBB (n = 5 male mice per group). (B) Evans blue examination showed that the BBB was disrupted gradually by FTY720, and the BBB recovered after discontinuing FTY720. (C) The tracer (red) was confined to the capillaries (green) in Mfsd2a+/− mice and D12 mice, and D6 mice showed higher permeability than D2 mice (n = 3 male mice per group). (D) Whole-mount images showed that Mfsd2a−/− mice had a pattern of permeability similar to that in D4 mice (n = 6 male mice per group). (E) Quantification of Evans blue staining showed similar Evans blue leakage in the brain parenchyma in Mfsd2a−/− mice and D4 mice. (F) Both Mfsd2a−/− and D4 mice showed tracer leakage (yellow arrows, n = 3 male mice per group). (G and H) Concentrations of total S1P in the cytoplasm and the ECM; the S1P concentration in the ECM was reduced in the Mfsd2a−/− mice compared with Mfsd2a+/− mice, but there was no significant difference in the S1P concentration in the cytoplasm (G, MS tests; H, ELISA tests). Scale bars: 4 mm in A and D; 100 μm in C and F. Error bars: SEM. Significance determined by Students t-test: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05, n.s. P > 0.05. Photo credit: Zhifu Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Fig. 2 Spns2 is the major transporter of S1P.

    Compared to Mfsd2a deficiency, Spns2 deficiency results in a decreased S1P concentration and the increased permeability of the BBB. (A) Strategy used for Spns2-RNAi transfection. (B) Western blot analysis showed that Spns2 was knocked down at D28 in the cortex when compared to that in the contralateral cortex (n = 3 male mice per group). (C) Immunostaining for Spns2 and claudin-5 showed that the expression of claudin 5 was downregulated after Spns2 inhibition (n = 3 male mice per group). (D) Quantification of the area of claudin 5-positive ECs in cortex (n = 5 male mice per group). (E) Quantitative analysis indicated that the S1P concentration in the ECM in the cortex of Spns2- deficient mice was lower than that in Mfsd2a-deficient mice. (F) The cerebral cortex was permeable to Evans blue (black arrowhead) when Spns2 was knocked down (n = 3 male mice per group). (G and H) S1P or PBS was added in situ at 23 days post AAV injection; whole-mount images showed that additional S1P decreased Evans blue leakage, whereas PBS had no effect; quantification of Evans blue showed that compared with PBS, additional S1P had a significant effect on BBB breakdown (n = 4 male mice per group). (I) Immunostaining showed that the tracer (red) was confined to the vessels (green) after adding S1P, but tracer leaked (yellow arrows) from the vessels after adding PBS. (n = 3 male mice per group). cc, corpus callosum; LV, lateral ventricle. Scale bars: 100 μm in C; 50 μm in I. Error bars: SEM. Significance determined by Students t-test: ***P < 0.001, n.s. P > 0.05. Photo credit: Fan Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Fig. 3 The S1P signaling pathway is crucial for the maintenance of the BBB.

    Knock down of S1P1 in the hippocampus led to BBB breakdown. (A) Strategy used for S1P1-RNAi transfection. (B) Immunostaining for S1P1 showed that the expression of S1P1 was inhibited after RNAi transfection. (C) Western blot showing that S1P1 knockdown had no substantial effect on the expression of Sphk1 at D28. (D) S1P or PBS was added in situ at 23 days post AAV injection; Evans blue leakage was confined to the hippocampus (black arrowheads). (E) Quantification of Evans blue staining showed that additional S1P had no effect on BBB breakdown. (F) The inhibition of S1P1 was not affected by additional PBS or S1P. (G) The tracer penetrated into the brain parenchyma, indicating that the BBB did not recover after adding S1P. Scale bars: 200 μm in B and F; 100 μm in G. Error bars: SEM. Significance determined by Students t-test: ***P < 0.001, n.s. P > 0.05. Each image is representative of three individual male mice. Photo credit: Fan Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Fig. 4 A S1P-enriched microenvironment improves the stability of the S100A8/A9 complex in brain ECs.

    (A) Quantitative RT-PCR (qRT-PCR) analysis of transcytosis-related genes showed that brain ECs showed increases in S100A8 in Mfsd2a-deficient mice. (B) Immunostaining for calprotectin and VE-cad showing that brain ECs express calprotectin. (C and D) Whole-mount images and quantification showed that additional S1P decreased Evans blue leakage in Mfsd2a−/− mice. (E) The tracer was restricted to the capillaries after S1P injection. (F) Western blotting (Native-PAGE) showed that S100A8 was upregulated and calprotectin dissociated in ECs sorted from Mfsd2a-deficient mouse cortex; additional S1P reversed this phenotype. (G) Immunostaining for calprotectin and VE-cad showing the discontinuous distribution of calprotectin in ECs in Mfsd2a-deficient mouse cortex, and the distribution of calprotectin returned to normal after S1P injection. (H) Immunostaining for calprotectin in the cortex. (I) Quantitative analysis of the area of discontinuous calprotectin distribution. in cortical ECs. Scale bars: 100 μm in B; 50 μm in E and G; 200 μm in H. Error bars: SEM. Significance determined by Students t-test: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05, n.s. P > 0.05. Each result is representative of three individual mice. Photo credit: Fan Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Fig. 5 A S1P-enriched microenvironment is required specifically to decrease the permeability and transcytosis in brain ECs.

    (A) Endothelium contained many vesicles of four types: Lum. type I [black arrowheads in (C)], Lum. type II [black arrows in (C)], Cytoplasmic [red arrowheads in (C)], and Abluminal [red arrows in (C)]. (B) Vesicular density quantification showed that additional S1P suppressed the transcytosis in Mfsd2a−/− mice [as shown in (C)]. (C) The transcytosis of adult Mfsd2a−/− mice injected with HRP was significantly increased. In wild-type littermates and Mfsd2a−/− mice with added S1P, HRP activity is confined to the lumen and there are no HRP-filled vesicles. (n = 3 mice per group) (D) HEK293 cells were incubated with S1P-TAMRA for fifteen days and then transfected with vehicle, Mfsd2a or Spns2 at D15. The fluorescence images showed that S1P (red) was enriched around the membrane after transfecting Mfsd2a. (E and F) Immunoprecipitation (IP) showed that Mfsd2a and Spns2 form protein complexes in brain ECs. (G) Schematic showing the mechanism of S1P transport by Mfsd2a and Spns2 in ECs of brain. L, lumen; E, endothelium. WT: wild-type. Scale bars: 500 nm in (C); 20 μm in (D). Error bars: SEM. Significance determined by Students t-test: ***P < 0.001, **P < 0.01, n.s. P > 0.05.Photo Credit: Zhifu Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Fig. 6 S1P influences the formation of the BBB in embryos.

    Both FTY720 D3 and Mfsd2a−/− embryos showed BBB breakdown. (A) Survival analysis of wild-type embryos after FTY720 injection. (n = 11 embryos per group). (B) Quantification of Evans blue in embryonic brains showing that FTY720 interfered with BBB integration (n = 5 embryos per group). (C) Leakage of the tracer (yellow arrowheads) from the vessel lumen in an embryonic brain after dosing with FTY720 (n = 3 embryos per group). (D) Western blot showing that a proportion of calprotectin dissociated into S100A8 and S100A9 after FTY720 injection (n = 3 embryos per group). (E) Quantitative analysis showed that FTY720 had no effect on S1P concentration in embryonic brains, whereas Mfsd2a deficiency led to a reduction in S1P concentration in the ECM. (F) Immunostaining for calprotectin and VE-cad showing the discontinuous distribution of Calprotectin in both dosed embryos and Mfsd2a−/− embryos (n = 3 embryos per group). Scale bars: 80 μm in C; 200 μm in F; 100 μm in F’-F’’’. Error bars: SEM. Significance determined by Students t-test: ***P < 0.001, *P < 0.05, n.s. P > 0.05. Photo credit: Fan Wang, State Key Laboratory of Medical Neurobiology, the Institutes of Brain Science and the Collaborative Innovation Center for Brain Science, Shanghai Medical College, Fudan University.

  • Table 1 AAV: AAV9-Spns2-RNAi; AAV9-S1P1-RNAi (Shanghai GeneChem).

    5′STEMLoopSTEM3′
    Spns2-RNAiACCGGTACCAAGAACACACGCACATTCTCGAGAATGTGCGTGTGTTCTTGGTATTTTT
    S1P1-RNAiTCTAAAAAACTGACTTCAGTGGTGTTCACTCGAGTGAACACCACTGAAGTCAGC
    ControlCGCTGAGTACTTCGAAATGTC

Supplementary Materials

  • Supplementary Materials

    Mfsd2a and Spns2 are essential for sphingosine-1-phosphate transport in the formation and maintenance of the blood-brain barrier

    Zhifu Wang, Yongtao Zheng, Fan Wang, Junjie Zhong, Tong Zhao, Qiang Xie, Tongming Zhu, Fukai Ma, Qisheng Tang, Bin Zhou, Jianhong Zhu

    Download Supplement

    This PDF file includes:

    • Figs. S1 to S10

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article