Research ArticlePLANT SCIENCES

Artificial regulation of state transition for augmenting plant photosynthesis using synthetic light-harvesting polymer materials

See allHide authors and affiliations

Science Advances  26 Aug 2020:
Vol. 6, no. 35, eabc5237
DOI: 10.1126/sciadv.abc5237
  • Fig. 1 Schematic diagram of CP PBF for augmenting the photosynthesis of C. pyrenoidosa and the spectroscopic characterization of PBF and C. pyrenoidosa.

    (A) PBF binds to the surface of C. pyrenoidosa and increases the light-dependent reaction and light-independent reactions. RuBP, ribulose 1,5-bisphosphate; 3-PGA, 3-phosphoglycerate; G3P, glyceraldehyde 3-phosphate; R5P, ribulose 5-phosphate; PRK, phosphoribulokinase. (B) The chemical structure of polymer PBF. (C) Normalized ultraviolet (UV)–visible absorption and fluorescence spectra of PBF and C. pyrenoidosaex = 550 and 470 nm, respectively). (D) The fluorescence decay kinetics curves of PBF and C. pyrenoidosa/PBF by monitoring the emission at 610 nm with an excitation wavelength of 550 nm. IRF was the instrument response function which was measured to improve the temporal resolution of fluorescence lifetime measurements.

  • Fig. 2 Characterization of the interaction between PBF and C. pyrenoidosa.

    (A) Superresolution STED images and (B) 3D CLSM images of C. pyrenoidosa/PBF complexes. Red color represents C. pyrenoidosaex = 633 nm, λem = 650 to 750 nm), and green color represents PBF (λex = 559 nm, λem = 580 to 620 nm). SEM images of C. pyrenoidosa (C) and C. pyrenoidosa/PBF complexes (D). Flow cytometry scatter plot and FACS analysis of C. pyrenoidosa in the absence (E) and in the presence (F) of PBF. (G) Variation of observed ΔHobs against the PBF/C. pyrenoidosa molar ratio by titrating PBF into C. pyrenoidosa suspensions. (H) Zeta potentials of C. pyrenoidosa before and after binding with PBF.

  • Fig. 3 The promotion of the physiological activity of C. pyrenoidosa by PBF.

    (A) The growth curves of C. pyrenoidosa cultivated in the illumination incubator in the absence or presence of PBF at different concentrations (temperature, 25°C; light intensity, 1500 l×; 12 hours of light and 12 hours of darkness). (B) The time course of oxygen evolution of C. pyrenoidosa and C. pyrenoidosa/PBF under illumination intensity of 300 μmol m−2 s−1. (C) The quantities of oxygen evolution of C. pyrenoidosa and C. pyrenoidosa/PBF at 1800 s under different illumination intensity. (D) The NADPH, NADP+, and ATP contents of C. pyrenoidosa and C. pyrenoidosa/PBF.

  • Fig. 4 The improvement of PBF on the light-dependent reactions and light-independent reactions of C. pyrenoidosa.

    (A) The fluorescence emission spectra of C. pyrenoidosa and C. pyrenoidosa/PBF (λex = 380, 440, 470, and 650 nm) at 77 K. (B) Schematic diagram of PBF induced state transition of C. pyrenoidosa. PBF improved PSI activity, which made more LHCII be combined to PSII and more C. pyrenoidosa in state 1. (C) Chlorophyll fluorescence kinetics curves of PBF, C. pyrenoidosa, and C. pyrenoidosa/PBF. (D) The spider plot of chlorophyll fluorescence parameters of C. pyrenoidosa and C. pyrenoidosa/PBF under dark adaptation. (E) A simplified scheme for energy cascade from light absorption to electron transport. (F) Chlorophyll fluorescence characteristics of C. pyrenoidosa and C. pyrenoidosa/PBF under light adaptation. (G) PSI quantum yields in C. pyrenoidosa and C. pyrenoidosa/PBF. (H) P700 kinetics tested by monitoring changes in absorbance at 705 nm during a 20-s illumination. (I) The RuBisCO activity of C. pyrenoidosa cultured in the presence and absence of PBF. (J) Relative mRNA expression level of rbcL and prk in C. pyrenoidosa cultured in PBF. (K) The protein, lipid, and carbohydrate contents in C. pyrenoidosa cultured in the presence and absence of PBF. *P < 0.05, **P < 0.01, and ***P < 0.001 relative to control (Tukey’s test). a.u., arbitrary units.

  • Fig. 5 The effect of PBF on growth phenotype of A. thaliana.

    (A) CLSM images of the roots of A. thaliana that were grown in growth medium containing PBF. Red color represents PBF (λex = 559 nm; λem = 580 to 620 nm). (B) Chlorophyll fluorescence imaging of A. thaliana that were grown in growth medium containing different concentration of PBF at the third and fourth week. (C) The photographs of A. thaliana that were grown in growth medium containing different concentration of PBF at the fifth week. Photo credit: X. Zhou, Chinese Academy of Sciences.

  • Fig. 6 The effect of PBF on photosynthesis and cell cycle of A. thaliana.

    Chlorophyll fluorescence kinetics of A. thaliana at the third week, including effective PSII quantum yield Y(II) (A), electron transport rate (B), and quantum yield of light induced nonphotochemical quenching Y(NPQ) (C). The concentration of PBF was 1 μM. (D) The photochemical efficiency (ɸPSII) of A. thaliana at the third week that were grown in growth medium containing different concentration of PBF. (E) The nuclear ploidy distributions of A. thaliana at the third week that were grown in growth medium containing different concentration of PBF. Flow cytometry histograms for the ploidy analysis of A. thaliana (F) and A. thaliana treated with 1 μM PBF (G).

  • Table 1 Primers for quantitative reverse transcription polymerase chain reaction detection of expression genes in C. pyrenoidosa.

    Primers for quantitative reverse transcription polymerase chain reaction detection of expression genes in C. pyrenoidosa..

    GenePrimer sequence (5′→3′)Length of
    production
    prkAGGAGAAGGCGGTGACTG116
    GACGTGGTTGTAGATGGG
    rbcLAAACTGGTGAAATTAAAGGGC195
    CACGGTGAATGTGTAAAAGAA
    β-ActinTTTGACTCAACACGGGAAAAC115
    CAACCCACCAACTAAGAACGG

Supplementary Materials

  • Supplementary Materials

    Artificial regulation of state transition for augmenting plant photosynthesis using synthetic light-harvesting polymer materials

    Xin Zhou, Yue Zeng, Yongyan Tang, Yiming Huang, Fengting Lv, Libing Liu, Shu Wang

    Download Supplement

    This PDF file includes:

    • Scheme S1
    • Figs. S1 to S5
    • Tables S1 to S4

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article