Research ArticleHEALTH AND MEDICINE

Editing a γ-globin repressor binding site restores fetal hemoglobin synthesis and corrects the sickle cell disease phenotype

See allHide authors and affiliations

Science Advances  12 Feb 2020:
Vol. 6, no. 7, eaay9392
DOI: 10.1126/sciadv.aay9392
  • Fig. 1 LRF-binding site disruption induces γ-globin expression in HUDEP-2 cells.

    (A) Schematic representation of the β-globin locus on chromosome 11, depicting the hypersensitive sites of the locus control region (white boxes) and the HBE1, HBG2, HBG1, HBD, and HBB genes (colored boxes). The sequence of the HBG2 and HBG1 identical promoters (from −210 to −100 nucleotides upstream of the HBG TSS) is shown below. Black arrows indicate HPFH mutations described at HBG1 and/or HBG2 promoters, with the percentage of HbF in heterozygous carriers of HPFH mutations (42). The highest HbF levels were generally observed in individuals carrying SCD (*) or β-thalassemia mutations (**). LRF- and BCL11A-binding sites [as described in (11)] are highlighted by orange and green boxes, respectively. The −114/−102 13-bp HPFH deletion is indicated by an empty box. Red arrows indicate the gRNA cleavage sites. (B to E) Globin expression analyses were performed in mature erythroblasts differentiated from Cas9-GFP+ HUDEP-2 cells. Results are shown as means ± SEM of three to four independent experiments. (B) RT-qPCR quantification of (Gγ + Aγ)- and β-globin transcripts. mRNA levels were expressed as percentage of (γ + β) globins, after normalization to α-globin mRNA levels. (C) Representative flow cytometry plots showing the percentage of HbF+ cells. (D) RP-HPLC analysis of globin chains. β-Like globin expression was normalized to α-globin. Representative RP-HPLC chromatograms are reported together with the expression of γ-globin chains (in brackets). The ratio of α chains to non–α chains was similar between HBG-edited and control samples. (E) ChIP-qPCR analysis of H3K27Ac at HBB and HBG promoters in −197-edited HUDEP-2 cells and control AAVS1–edited samples (day 5 of differentiation, n = 3). ChIP was performed using an antibody against H3K27Ac and the corresponding control immunoglobulin G (IgG). ****P ≤ 0.0001, ***P ≤ 0.001, **P ≤ 0.01, and *P ≤ 0.05 (unpaired t test). SSC, side scatter. (F) ChIP-qPCR analysis of LRF at HBG promoters in −197-edited and control AAVS1–edited K562 cells (n = 2 biologically independent experiments). ChIP was performed using an antibody against LRF. Two different primer pairs were used to amplify the HBG promoters (A and B). KLF1 and DEFB122 served as positive and negative controls, respectively.

  • Fig. 2 Efficient editing of HBG promoters in HSPCs.

    (A) Deep sequencing analysis of genome editing events in mature erythroblasts derived from adult SCD and CB healthy donor HSPCs. The InDel profile was unchanged between SCD and healthy donor cells. Frequencies of substitutions (subst), insertions (ins), and deletions (del) are shown as percentages of total InDels. The proportion of >1-bp deletions associated or not with MH motifs is indicated. The frequency of >1-bp deletions associated with MH motifs was significantly lower for the −196 gRNA compared to the −197 (P ≤ 0.01) and −195 (P ≤ 0.001) gRNAs. Data are expressed as means ± SEM (n = 3 to 4, two to three donors). (B) Genome editing efficiency in BFU-E and CFU-GM progenitors derived from edited SCD HSPCs as evaluated by TIDE. Data are expressed as means ± SEM (n = 2 to 5, two SCD donors). (C) Genome editing in single BFU-E and CFU-GM colonies derived from SCD HSPCs as evaluated by TIDE. We plotted the number of edited HBG promoters. In the −158 sample, the donor did not harbor the −158 SNP. (D) InDel profiles generated by each gRNA as analyzed by deep sequencing. The length of MH motifs associated with specific InDels is indicated. Data are expressed as means ± SEM (n = 3 to 4, two to three donors). (E) Genome editing efficiency in subpopulations of −197- and −196-edited CB-derived HSPCs. Cells were FACS-sorted based on the expression of CD34, CD133, and CD90, and genome editing efficiency was determined in committed (CD34+CD133), early (CD34+CD133+CD90), and primitive (CD34+CD133+CD90+) progenitors. We plotted the data of three independent experiments starting from unsorted HSPCs with low, medium, and high genome editing efficiency (three donors).

  • Fig. 3 γ-Globin reactivation and amelioration of the SCD cell phenotype following disruption of LRF-binding site in SCD HSPCs.

    (A) (Gγ + Aγ)- and βS-globin transcript levels detected by RT-qPCR in primary mature erythroblasts. Values are expressed as percentage of (γ + βS)-globin mRNAs after normalization to α-globin. (B) Representative flow cytometry plots showing the percentage of HbF+ cells in RBC populations derived from control and HBG-edited SCD HSPCs. (C) RP-HPLC quantification of γ-, βS-, and δ-globin chains. β-Like globin expression was normalized to α-globin. The ratio of α chains to non–α chains was similar between control and HBG-edited samples. Data are expressed as means ± SEM. (D) Quantification of total HbF (HbF + AcHbF), HbS, and HbA2 by CE-HPLC. We plotted the percentage of each Hb type over the total Hb tetramers. (E and F) In vitro sickling assay of RBCs derived from edited SCD HSPCs under hypoxic conditions (0% O2). (E) Representative photomicrographs of RBCs derived from control and HBG-edited SCD HSPCs at 0% O2. Scale bar, 20 μm. (F) Proportion of non-sickled RBCs (0% O2). (A to F) Data are expressed as means ± SEM (n = 3 to 7, two SCD donors). ****P ≤ 0.0001, ***P ≤ 0.001, **P ≤ 0.01, and *P ≤ 0.05 versus AAVS1 sample (unpaired t test).

  • Fig. 4 Editing efficiency in repopulating HSPCs.

    (A) Engraftment of human cells in NSG mice transplanted with untreated (UT) and edited mobilized healthy donor CD34+ cells (n = 4 mice for each group) 16 weeks after transplantation. Engraftment is represented as percentage of human CD45+ cells in the total murine and human CD45+ cell population, in bone marrow (BM), spleen, thymus, and blood. Values shown are means ± SEM; *P ≤ 0.05 versus untreated [one-way analysis of variance (ANOVA)]. (B) Editing efficiency in the bone marrow– and spleen-derived human CD45+ progeny of repopulating HSPCs, as evaluated by Sanger sequencing and TIDE analysis. The proportion of edited alleles in the input HSPC populations (〇: HSPCs cultured for 6 days in “HSPC medium”; □: BFU-E; △: CFU-GM) is indicated (input). Values shown are means ± SEM. Each data point represents an individual mouse. (C) Genome editing efficiency in the input populations and in bone marrow– and spleen-derived human CD45+ populations edited with the −197, −196, or −115 gRNAs, as evaluated by Sanger sequencing and TIDE analysis. The main events associated with MH-motifs are indicated. Values shown are means ± SEM (n = 4 mice per group). ***P ≤ 0.001, **P ≤ 0.01, and *P ≤ 0.05 versus input (unpaired t test).

  • Table 1 gRNA target sequences.

    Protospacer adjacent motifs (PAMs) are highlighted in bold.

    gRNATarget sequence (5′ to 3′)Position (hg19)Strand
    AAVS1GGGGCCACTAGGGACAGGATTGGchr19: 55627120–55627139
    −197ATTGAGATAGTGTGGGGAAGGGGchr11: 5271268–5271287 (HBG1)+
    chr11: 5276192–5276211 (HBG2)
    −196CATTGAGATAGTGTGGGGAAGGGchr11: 5271267–5271286 (HBG1)+
    chr11: 5276191–5276210 (HBG2)
    −195GCATTGAGATAGTGTGGGGAAGGchr11: 5271266–5271285 (HBG1)+
    chr11: 5276190–5276209 (HBG2)
    −158TATCTGTCTGAAACGGTCCCTGGchr11: 5271243–5271262 (HBG1)
    chr11: 5276167–5276186 (HBG2)
    −152CCATGGGTGGAGTTTAGCCAGGGchr11: 5271223–5271242 (HBG1)+
    chr11: 5276147–5276166 (HBG2)
    −151CCCATGGGTGGAGTTTAGCCAGGchr11: 5271222–5271241 (HBG1)+
    chr11: 5276146–5276165 (HBG2)
    −115CTTGTCAAGGCTATTGGTCAAGGchr11: 5271186–5271205 (HBG1)+
    chr11: 5276110–5276129 (HBG2)
  • Table 2 Primer used to detect InDel events.

    F, forward primer; R, reverse primer.

    Amplified regionF/RSequence (5′ to 3′)
    HBG1 + HBG2
    promoters
    FAAAAACGGCTGACAAAAGAAGTCCTGGTAT
    RATAACCTCAGACGTTCCAGAAGCGAGTGTG
    HBG1 promoterFTACTGCGCTGAAACTGTGGC
    RGGCGTCTGGACTAGGAGCTTATTG
    HBG2 promoterFGCACTGAAACTGTTGCTTTATAGGAT
    RGGCGTCTGGACTAGGAGCTTATTG
    AAVS1FCAGCACCAGGATCAGTGAAA
    RCTATGTCCACTTCAGGACAGCA
  • Table 3 Primers used for digital droplet PCR.

    Amplified regionF/RSequence (5′ to 3′)
    HBG1-HBG2
    intervening region
    FGTTTTAAAACAACAAAAATGAGGGAAAGA
    RGTTGCTTTATAGGATTTTTCACTACAC
    Chr11 control regionFCCCTTCCGAGAGGATTTAGG
    RAGTCGGGATCTGAACAATGG
  • Table 4 Primers used for deep sequencing.

    Amplified
    region
    F/RSequence (5′ to 3′)
    HBG
    promoters
    FGGAATGACTGAATCGGAACAAGG
    RCTGGCCTCACTGGATACTCT
    OT −197.1FGTGGGTTATAGAAAGGGCAAGCTG
    RCCTTCCACTCAGATCTTGCCC
    OT −197.2FCATCTAAGAGATTGGCAAAAATTATAGAGTCCCAAC
    RGTAATGTGATTGCTGGGTTGAGCC
    OT −197.3FCTTCTCAAAAGAGCTAGGTGGCTG
    RGGGCCAGTACTTCCCTCTTTTTAG
    OT −197.4FGATAGCACTGGCAACCTGTTTCTG
    RCTTCACTGTTTTGAGCCTCAGTTTCATTCC
    OT −197.5FCCTCTTCTCTCCTCCCCTAAC
    RCCTGCTGTGTTCTAGGCTCTAAG
    OT −196.1FGTGGGTTATAGAAAGGGCAAGCTG
    RCCTTCCACTCAGATCTTGCCC
    OT −196.2FGCCGGGTTAAGGGCGTAGAA
    RCCCCTCAAACCCACTCTTAAAACC
    OT −196.3FATCACTTAAACAAGGATGCTCACCTCAGGTTC
    RCGGTCCAACCTGGAAATCTCTG
    OT −196.4FCCCCTTTCATTTACTAACCAGGCATACC
    RGAGGGGCTTTTACTGGGCAATTG
    OT −196.6FGTTATGGACTGTAGCAGGACAAGC
    RGTTGTGAGCCCTTAAAAGGCACAG
    OT −195.1FACAAACCATTGTGTGGGACTTTGGAGAC
    RCTATGCCATGTACTCTCCCTGAC
    OT −195.2FCATGCCATGAAGGAAAATAAAGCAAGGTAAGAAG
    RCTAATACATTTCCTTACTTCATTCACGTCACTGC
    OT −115.1FATTGGGGGAGACAGACCCATG
    RCATTTTTATCCAGCTTGGCAGGGG
  • Table 5 Primer sequences used for RT-qPCR.

    Amplified regionF/RSequence (5′ to 3′)
    HBAFCGGTCAACTTCAAGCTCCTAA
    RACAGAAGCCAGGAACTTGTC
    HBBFGCAAGGTGAACGTGGATGAAGT
    RTAACAGCATCAGGAGTGGACAGA
    HBG1 + HBG2FCCTGTCCTCTGCCTCTGCC
    RGGATTGCCAAAACGGTCAC
    HBDFCAAGGGCACTTTTTCTCAG
    RAATTCCTTGCCAAAGTTGC
    HBEFCTTTGGAAACCTGTCGTC
    RCTTGCCAAAGTGAGTAGC
    GATA1FGACAGGACAGGCCACTACCTATG
    RAGTACCTGCCCGTTTACTGACAA
    ALAS2FCAGCGCAATGTCAAGCAC
    RTAGATGCCATGCTTGGAGAG
    BAND3FACCTCTCTCACCTCACCTTCTG
    RAACCTGTCTAGCAGTTGGTTGG
    GAPDHFGAAGGTGAAGGTCGGAGT
    RGAAGATGGTGATGGGATTTC
  • Table 6 Primers used for ChIP-qPCR (H3K27Ac).

    Amplified regionF/RSequence (5′ to 3′)
    HBBFTGCTCCTGGGAGTAGATTGG
    RTGGTATGGGGCCAAGAGATA
    HBGFACAAGCCTGTGGGGCAAGGTG
    RGCCAGGCACAGGGTCCTTCC
  • Table 7 Primers used for ChIP-qPCR (LRF).

    Amplified regionF/RSequence (5′ to 3′)
    HBG AFTCAATGCAAATATCTGTCTGAAACG
    RCAAGGCTATTGGTCAAGGCAA
    HBG BFCAAATATCTGTCTGAAACGGTCCC
    RACTCTAAGACTATTGGTCAAGTTTGC
    KLF1FCCCAACCCAGGCAAATTG
    RGGGCTGGGAGTTGGGTCTT
    DEFB122FTGTGGCTGGTCCTTGGGCTT
    RGTGGCTCCTGCCGTGACGAA

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/7/eaay9392/DC1

    Fig. S1. Genome editing efficiency in erythroid cell lines.

    Fig. S2. Erythroid maturation and γ-globin induction in HBG-edited HUDEP-2 cells.

    Fig. S3. Cas9/gRNA RNP delivery to HSPCs leads to efficient HBG promoter editing.

    Fig. S4. Deletion frequency at each nucleotide of the HBG promoters.

    Fig. S5. Genome editing in stem/progenitor populations.

    Fig. S6. Erythroid maturation and γ-globin induction in HBG-edited erythroid cells derived from SCD HSPCs.

    Fig. S7. Off-target analysis.

    Fig. S8. Human hematopoietic cell reconstitution in NSG mice transplanted with control and edited HSPCs.

    Table S1. Deep sequencing analysis of edited HBG promoters in SCD HSPC-derived erythroblasts.

    Table S2. Sanger sequencing analysis of −115-edited HBG1 and HBG2 promoters in SCD HSPC-derived erythroblasts.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. Genome editing efficiency in erythroid cell lines.
    • Fig. S2. Erythroid maturation and γ-globin induction in HBG-edited HUDEP-2 cells.
    • Fig. S3. Cas9/gRNA RNP delivery to HSPCs leads to efficient HBG promoter editing.
    • Fig. S4. Deletion frequency at each nucleotide of the HBG promoters.
    • Fig. S5. Genome editing in stem/progenitor populations.
    • Fig. S6. Erythroid maturation and γ-globin induction in HBG-edited erythroid cells derived from SCD HSPCs.
    • Fig. S7. Off-target analysis.
    • Fig. S8. Human hematopoietic cell reconstitution in NSG mice transplanted with control and edited HSPCs.
    • Table S1. Deep sequencing analysis of edited HBG promoters in SCD HSPC-derived erythroblasts.
    • Table S2. Sanger sequencing analysis of −115-edited HBG1 and HBG2 promoters in SCD HSPC-derived erythroblasts.

    Download PDF

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article