Research ArticleCANCER

Interfering MSN-NONO complex–activated CREB signaling serves as a therapeutic strategy for triple-negative breast cancer

See allHide authors and affiliations

Science Advances  19 Feb 2020:
Vol. 6, no. 8, eaaw9960
DOI: 10.1126/sciadv.aaw9960
  • Fig. 1 MSN was highly expressed in TNBC and positively correlated with the breast cancer malignancy.

    (A) We performed RNA-seq on 43 TNBC and 38 non-TNBC cell lines or clinical samples. The relative expression values of genes used in the heatmap are processed as follows: Relative expression value of gene = log2 (actual measured value +1). (B) The results of RNA-seq were statistically analyzed. The samples were divided into two groups by median of MSN expression, MSN high and MSN low. Then, the proportion of TNBC and non-TNBC in the two groups was shown as a dot plot (left). The results of RNA-seq were used to analyze the difference of MSN expression between TNBC and non-TNBC (right). (C) The expression of MSN was analyzed in different subtypes of breast cancer samples from the dataset (TCGA Breast Cancer Illumina HiSeq percentile), which was contained in the online University of California Santa Cruz (UCSC) Xena database. RSEM, RNA-seq by expectation-maximization. (D) The expression of MSN was analyzed in breast cancer cell lines of different subtypes from the dataset (Heiser 2012) contained in the online UCSC Xena database. Lu, luminal subtype; Ba, basal subtype. (E) Immunohistochemical staining was used to detect the expression of MSN in tumor sections from 22 cases of patients with TNBC and 28 cases of non-TNBC. Scale bars, 80 μm. The histo-score (H-score) statistics are shown on the right. (F) The overall survival (OS) of patients grouped by high and low MSN expression in breast cancer from the NKI dataset contained in an online database (PROGgeneV2). (G) MSN expression level measured by qRT-PCR (left) or Western blot (right) in eight breast cancer cell lines that contain four subtypes. TBP, TATA-box binding protein. ***P < 0.001 by unpaired t test of triplicates. Error bars, means ± SEM.

  • Fig. 2 MSN positively regulated the progression of breast cancer.

    (A) qRT-PCR (top) and Western blot (bottom) was used to verify the knockdown or overexpression effect of MSN. (B) MTT assay was performed to determine the difference of cell proliferation ability after MSN knockdown or overexpression (n = 6). (C) Invasion assay was carried out with MSN knockdown (left) or MSN-overexpressing (right) MDA-MB-231 cells. Quantitative analysis of the total invasive cells of triplicates is shown as a bar graph. Scale bars, 200 μm (left) and 400 μm (right). CTRL, control. (D) Soft agar colony formation assay was performed using MSN knockdown MDA-MB-231 cells and MSN-overexpressing T47D or MDA-MB-231 cells. Colonies were counted in the whole field showed on the right (n = 3). (E) MDA-MB-231 shCTRL or shMSN cells were implanted into the fourth mammary fat pads at two flanks of nude mice, 1 million cells per site (n = 5). The tumor volume was measured once a week. T47D CTRL or MSN-overexpressing cells were implanted into the fourth mammary fat pads at two flanks of nude mice, 2 million cells per site (n = 5). The tumor volume was measured once every 2 weeks. MDA-MB-231 CTRL or MSN-overexpressing cells of 0.5 million were implanted into the fourth mammary fat pads at two flanks of nude mice (n = 5). The tumor volume was measured at indicated time. At the end of experiments, the tumors were taken out and the images are shown. Ki67 staining was performed by IHC (immunohistochemistry), and Ki67-positive proportions are shown on the right. Scale bars, 80 μm. Photo credit: Yuanyuan Qin, University of Science and Technology of China. **P < 0.01 and ***P < 0.001 by unpaired t test of triplicates or test of two-way ANOVA versus shCTRL or CTRL group. Error bars, means ± SEM.

  • Fig. 3 Effects of MSN in regulating breast cancer are dependent on its T558 phosphorylation.

    (A) Western blot was performed to determine the phosphorylation level of MSN T558 site after changing MSN expression. (B) qRT-PCR and Western blot were carried out to verify the overexpression of MSN with different status. WT, wild type; T558A, mutant of threonine 558 replaced by alanine. T558E, mutant of threonine 558 replaced by glutamic acid. (C) Cell proliferation ability was measured by MTT assay (n = 6). (D) Cell invasion ability was measured by the invasion assay (n = 3). The image (left) and quantitative analysis of the total invasive cells (right) are shown. Scale bars, 200 μm. (E) Anchorage-independent growth ability was measured by the soft agar colony formation assay (n = 3). The image (left) and quantitative analysis of colonies (right) are shown. (F) MDA-MB-231 cells of 0.5 million were implanted into the fourth mammary fat pads at two flanks of nude mice (n = 5). The figure shows the representative results of two independent repetitive experiments. The tumor volume was measured as indicated. At the end of experiments, the tumors were taken out and the images are shown. (G) Ki67 staining of tumor tissue was conducted by IHC, and positive proportion is shown on the right. Scale bars, 80 μm. *P < 0.05, **P < 0.01, ***P < 0.001 by unpaired t test of triplicates or test of two-way ANOVA. Error bars, means ± SEM.

  • Fig. 4 Phosphorylated MSN enters nucleus to function for breast cancer progression with the assistance of a nuclear protein NONO.

    (A) We used anti-FLAG M2 magnetic beads to carry out immunoprecipitation experiments on MDA-MB-231–CTRL and FLAG-MSN–overexpressing cell lysates and identified the protein samples by mass spectrometry. The protein components and relative abundances are displayed by a heatmap. (B) Immunoprecipitated samples by anti-FLAG M2 Magnetic Beads of CTRL or FLAG-MSN–overexpressing T47D and MDA-MB-231 cells were separated by SDS–polyacrylamide gel electrophoresis and silver staining. The red box shows differential bands, which appear in both cell lines. M, marker. (C) CTRL or FLAG-MSN–overexpressing MDA-MB-231 cells were immunoprecipitated (IP) by anti-FLAG M2 Magnetic Beads and then immunoblotted (top). Anti-MSN antibody was incubated with Dynabeads protein A and Dynabeads protein G and then to immunoprecipitated samples of MDA-MB-231 cells and immunoblotted (bottom). IgG, immunoglobulin G. (D) Cytoplasmic (Cyto) and nuclear (Nu) proteins were separated according to instruction. Western blot was conducted to determine the distribution of MSN in CTRL or FLAG-MSN–overexpressing MDA-MB-231 cells. Tubulin, internal reference for cytoplasmic proteins and lamin for nuclear proteins. (E) Western blot was carried out to determine the distribution of wild-type MSN and its mutants in MDA-MB-231 cells. (F) Immunofluorescence assay was carried out, in which endogenous MSN was determined with anti-MSN antibody in CTRL cells, exogenous MSN was determined with anti-FLAG antibody in FLAG-MSN–overexpressing cells, and endogenous NONO was determined with anti-NONO antibody. Images were captured by confocal laser microscopy. Scale bars, 10 μm. (G) CTRL or different-status MSN-overexpressing MDA-MB-231 samples were immunoprecipitated with anti-FLAG M2 Magnetic Beads and immunoblotted. DAPI, 4′,6-diamidino-2-phenylindole. (H) Schematic diagram of NONO in different truncated forms. (I) CTRL or FLAG-tagged different NONO fragment-overexpressing MDA-MB-231 cells were immunoprecipitated with anti-FLAG M2 Magnetic Beads and immunoblotted. (J) Cytoplasmic and nuclear proteins were separated and immunoblotted after MSN overexpression and NONO knockdown in MDA-MB-231.

  • Fig. 5 MSN-NONO interaction activated CREB signaling to promote breast cancer progression by facilitating the nuclear localization of pPKC.

    (A) CREB phosphorylation level was measured by Western blot after overexpressing NONO in MDA-MB-231 cells by Western blot. (B) CREB phosphorylation level was determined in MSN-overexpressing MDA-MB-231 cells by Western blot. (C) CREB phosphorylation level was determined in MSN knockdown MDA-MB-231 cells by Western blot. (D) Western blot was used to measure CREB phosphorylation level after overexpressing MSN with different mutation status in MDA-MB-231 cells. (E) The downstream genes of CREB signaling from the results of RNA-seq of MDA-MB-231–shCTRL and MDA-MB-231–shMSN cells were shown as heatmap according to relative expression level. (F) The expression of CREB downstream genes ALS2 and CCNA1 was measured by qRT-PCR in MSN knockdown MDA-MB-231 cells. (G) The expression of CREB downstream genes ALS2 and CCNA1 was measured by qRT-PCR in MSN-overexpressing MDA-MB-231 or T47D cells. (H) Phosphorylation level and total proteins of CREB were determined in MSN-overexpressing and NONO-knocking down MDA-MB-231 cells by Western blot. (I) The expression of CREB downstream genes ALS2 and CCNA1 was measured in MSN-overexpressing and NONO-knocking down MDA-MB-231 cells by qRT-PCR. (J) The expression relationship between MSN and CREB downstream genes ALS2 or CCNA1 was analyzed in breast cancer cell lines from the dataset (Heiser 2012) contained in the UCSC Xena database. (K) CREB phosphorylation level was detected in MDA-MB-231 cells overexpressing NONO in different truncated forms by Western blot. (L) The immunoprecipitated samples obtained with anti-FLAG M2 Magnetic Beads of CTRL or FLAG-MSN–overexpressing MDA-MB-231 cells were conducted with Western blot. (M) Nuclear protein level of pPKCζ was observed after MSN knockdown by Western blot. (N) Nuclear protein level of pPKCζ was observed after NONO knockdown by Western blot. (O) pPKCζ level in cytoplasm and nucleus was determined by Western blot after overexpressing MSN with different mutagenesis. (P) We examined the effect of PKC inhibitor on the phosphorylation of CREB when overexpressing MSN by Western blot. *P < 0.05, **P < 0.01, and ***P < 0.001 by unpaired t test of triplicates. Error bars, means ± SEM.

  • Fig. 6 MSN-NONO complex and downstream CREB signaling pathway could be targeted for TNBC.

    (A) The expression of NONO was analyzed in different subtype breast cancer cell lines from the dataset (Heiser 2012) contained in the UCSC Xena database. (B) The expression of CREB downstream genes ALS2 or CCNA1 was analyzed in different subtype breast cancer cell lines from the dataset (Heiser 2012) contained in the UCSC Xena database. (C) The OS influenced by NONO expression in breast cancer from the dataset (NKI) contained in an online database (PROGgeneV2). (D) The OS influenced by ALS2 expression in breast cancer from the dataset (GSE9893) and CCNA1 expression from the dataset (NKI) contained in an online database (PROGgeneV2). (E) The lung free metastasis survival influenced by different combinations of high and low expression of MSN and NONO from integrated datasets including GSE5327, GSE2603, and GSE2034. (F) One hundred thousand cells digested from PDX of TNBC (#USTC11 established by our group) were implanted into the fourth mammary fat pads at two flanks of nude mice. After tumor initiation, mice were divided into four groups and treated with vehicle, DOC (10 mg/kg), 666-15 (10 mg/kg), or both once a week intraperitoneally. Tumor size was monitored once a week, and tumor image was taken after mice were euthanized (n = 5). Photo credit: Yuanyuan Qin, University of Science and Technology of China. (G) Schematic diagram of the whole research results. *P < 0.05, **P < 0.01, ***P < 0.001 by unpaired t test. Error bars, means ± SEM.

  • Table 1 The gene-specific primers used in qRT-PCR.

    Sequence (5′→3′)
    MSNForward: ATCACTCAGCGCCTGTTCTTReverse: CCCACTGGTCCTTGTTGAGT
    TBPForward: CACGAACCACGGCACTGATTReverse: TTTTCTTGCTGCCAGTCTGGAC
    ALS2Forward: AGATGGTGAGGTCTACAGCTTReverse: GAATGGGGCTACTTGGACAAAT
    CCNA1Forward: GAGGTCCCGATGCTTGTCAGReverse: GTTAGCAGCCCTAGCACTGTC
    NONOForward: GGCAGGCGAAGTCTTCATTCAReverse: TGGCAATCTCCGCTAGGGT
    CREBForward: ATTCACAGGAGTCAGTGGATAGTReverse: CACCGTTACAGTGGTGATGG
  • Table 2 The sense sequence of shRNAs.

    Sequence (5′→3′)
    MSNsh-1CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
    sh-4CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
    NONOsh-1CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
    sh-3CCGGGCAGGCGAAGTCTTCATTCATCTCGAGATGAATGAAGACTTCGCCTGCTTTTTG
    sh-5CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
    CREBsh-1CCGGGCTCGATAAATCTAACAGTTACTCGAGTAACTGTTAGATTTATCGAGCTTTTT
    sh-4CCGGCAGTGGATAGTGTAACTGATTCTCGAGAATCAGTTACACTATCCACTGTTTTT
    PRKCZsh-1CCGGCAAGCTCACAGACTACGGCATCTCGAGATGCCGTAGTCTGTGAGCTTGTTTTT
    sh-3CCGGACCTAATCAGAGTCATCGGGCCTCGAGGCCCGATGACTCTGATTAGGTTTTTT

Supplementary Materials

  • Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/8/eaaw9960/DC1

    Fig. S1. MSN regulates breast cancer progression.

    Fig. S2. Effects of MSN in regulating breast cancer are dependent on its T558 phosphorylation.

    Fig. S3. MSN can interact with NONO and enter the nucleus with the assistance of NONO.

    Fig. S4. The interaction between MSN and NONO is critical for MSN function on breast tumor progression.

    Fig. S5. The function of MSN was mediated by phosphorylation of CREB.

    Fig. S6. MSN-NONO interaction enhanced CREB signaling pathway.

    Fig. S7. MSN-NONO interaction promoted CREB phosphorylation by facilitating the nuclear localization of pPKCζ.

    Fig. S8. There was no significant difference in the expression of EZR and RDX in different subtypes of breast cancer cell lines.

    Fig. S9. MSN-NONO complex and downstream CREB signaling pathway could be targeted for TNBC.

    Fig. S10. Uncropped images from Western blots.

  • Supplementary Materials

    This PDF file includes:

    • Fig. S1. MSN regulates breast cancer progression.
    • Fig. S2. Effects of MSN in regulating breast cancer are dependent on its T558 phosphorylation.
    • Fig. S3. MSN can interact with NONO and enter the nucleus with the assistance of NONO.
    • Fig. S4. The interaction between MSN and NONO is critical for MSN function on breast tumor progression.
    • Fig. S5. The function of MSN was mediated by phosphorylation of CREB.
    • Fig. S6. MSN-NONO interaction enhanced CREB signaling pathway.
    • Fig. S7. MSN-NONO interaction promoted CREB phosphorylation by facilitating the nuclear localization of pPKCζ.
    • Fig. S8. There was no significant difference in the expression of EZR and RDX in different subtypes of breast cancer cell lines.
    • Fig. S9. MSN-NONO complex and downstream CREB signaling pathway could be targeted for TNBC.
    • Fig. S10. Uncropped images from Western blots.

    Download PDF

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article