Research ArticleDEVELOPMENTAL NEUROSCIENCE

Natural loss of function of ephrin-B3 shapes spinal flight circuitry in birds

See allHide authors and affiliations

Science Advances  11 Jun 2021:
Vol. 7, no. 24, eabg5968
DOI: 10.1126/sciadv.abg5968
  • Fig. 1 Spinal gait circuitry and EFNB3 genomics.

    (A and B) Schematic illustration of the morphology and wiring of the spinal cord in WT mouse (A) and in ephrin-B3/EphA4/α2-chimaerin mice collectively referred to as hopB3 mutants (B). (C) Simplified cladogram depicting the relations across representative vertebrate groups examined in this study. Branch lengths are arbitrary and not calibrated for time, red means EFNB3 is absent in galliforms, dark blue indicates branches with solid evidence of EFNB3 sequence divergence from nonavian groups, and light blue indicates branches with limited EFNB3 sequence data. (D) Comparison of EFNB3 synteny across representative organisms where synteny could be examined, with chromosomal location or data source indicated. EFNB3 (red) is absent in galliforms (red square), and DNAH2 (blue) is absent in birds. Nonavian sauropsids: lizards (e.g., green anole) and crocodiles (e.g., Chinese alligator). wgs, whole-genome shotgun contigs. SH2/3, Src homolog 2/3. (E) Schematic structure of the predicted mouse and avian ephrin-B3 proteins. RBD, receptor binding domain; TM, transmembrane domain.

  • Fig. 2 Zebra finch ephrin-B3 protein and mRNA expression.

    (A) The mouse and zebra finch proteins are presented on the cell membrane. An anti-myc antibody (9E10) was used for surface staining of COS-7 cells transiently transfected with N-terminal myc-tagged ephrin-B3 isoforms. The sequence of the full-length zebra finch ephrin-B3 transcript was reconstructed from RNA-seq reads using the Trinity platform (60) (fig. S1). DAPI, 4′,6-diamidino-2-phenylindole. (B) Binding assay shows EphA4-AP binding to mouse ephrin-B3 protein but not to GFP or to zebra finch ephrin-B3. (C) Representative EphA4-AP/ephrin-B3 binding curves assessed by AP activity in a colorimetric assay. Apparent KD value for mouse ephrin-B3 was 40.15 nM (n = 3). (D) In situ hybridization for ephrin-B3 mRNA in P0 zebra finch spinal cord. High expression is evident in the FP but declines along the RP. (D’) Normalized optical density (OD) profile of zebra finch ephrin-B3 midline expression; shown is the mean from 58 cross sections. (E) In situ hybridization for ephrin-B3 mRNA in E15.5 mouse spinal cord. High expression is evident in both the FP and RP. (E’) Normalized optical density profile of mouse ephrin-B3 midline expression; shown is the mean from 160 cross sections. (F and G) Analysis of the activity of the ephrin-B3 enhancer element, at E9 (F) and E15 (G). The cherry reporter gene was cloned downstream to the putative enhancer and electroporated into the chick spinal cord. GFP, under the control of the ubiquitous CAGG enhancer-promoter, was coelectroporated. The reporter is detected in both the FP and RP (F and G), similar to the pattern of ephrin-B3 expression in mice, while GFP is expressed ubiquitously.

  • Fig. 3 Expression of ephrin-B1, ephrin-B2, and EphA4 mRNAs in the chick spinal cord.

    In situ hybridization for ephrin-B1 (A and B), ephrin-B2 (C and D), and EphA4 (E and F) mRNAs at the brachial level in E10 (A, C, and E) and E16 (B, D, and F) cords. The FP is indicated by black arrows and the RP by magenta arrows. (A and B) Ephrin-B1 at E10 is high in the FP and low in the RP; at E16, it is high in the FP and low in ventral RP. (C and D) Ephrin-B2 at E10 is low in the FP and RP; at E16, it is low in ventral RP. (E and F) EphA4 expression at E10 is widespread in the gray matter, with higher levels in scattered interneurons, the lateral subdivision of the lateral motor columns (LMCl) and the medial motor columns (MMC). At E16, expression is detected in scattered interneurons and motoneurons. Interneurons invading the dorsal midline are apparent [white arrow in inset in (F)]. Insets in (E) and (F) are enlargements of the areas boxed in dashed yellow. (E’ and F’) Cell density distribution, obtained from 10 cross sections from the regions flanking the dorsal midline at E10 and E16, respectively [indicated by white dashed boxes in (E) and (F)]. (G) Summation of cell in situ hybridization relative intensity in the area indicated in (E’) (E10, blue) and (F’) (E16; red values are significantly different at the dorsal midline) (t test, P < 0.05, n = 10 per group).

  • Fig. 4 Spinal cord shows enlarged brachial RPs in hopB3 mutants, chick, and zebra finch.

    (A to D) Dark-field microphotographs of transverse sections of adult mouse spinal cord at lumbar and brachial levels. Compared are control heterozygous (EphA4lx/lx−) (A and C) and homozygous null mice (EphA4lx/lx−/PGK-Cre+) (B and D) (33). Right insets (enlargements of the boxed areas) depict the central canal and the RP and FP. (E and F) Transverse sections at the brachial (E) and lumbar (F) levels of E15 chick spinal cord. The white matter is labeled with the anti-neurofilament antibody 3A10, the gray matter with nuclear DAPI staining. Right inset [in (E)] is an enlargement of the boxed area. (G) Transverse section at the brachial level of P8 zebra finch. The white matter is labeled with the anti-neurofilament antibody 3A10. Right inset is an enlargement of the boxed area. (H) Box plot representation of the RP-to-FP length ratios at the brachial level in adult EphA4+/− mouse (N = 3, 36 cross sections), adult EphA4−/− mouse (N = 3, 36 sections), E15 chick (N = 2, 22 sections), and P0 zebra finch (N = 1, 25 sections). Comparing the RP/FP ratios across groups using Dunnett’s method (which takes into account multiple comparisons) shows significant differences between the heterozygous mouse and the null mouse, chick, and zebra finch. The circle charts shows the significance. No overlapping between the heterozygous mouse (red circle) and other groups (black circles) is indicative of P < 0.05 (see Supplementary Statistics).

  • Fig. 5 Midline crossing at the brachial and lumbar levels of chick spinal cord.

    (A) Dorsal midline crossing at brachial level in E15 chick demonstrated by neurofilament (3A10) immunostaining in transverse sections. Detailed views of three examples in insets; left inset is an enlargement of the boxed area in (A). Axons cross at the FP (yellow arrows) and the dorsal part of the RP (white arrows). (B) Dorsal midline crossing at brachial level in E17 chick; the boxed area is enlarged in (B’) and (B”). Anti-3A10 labels all axons, and anti-TAG1/axonin labels sensory axons. (C) Dorsal midline crossing is evident following unilateral expression of a reporter gene. GFP under the control of the CAGG enhancer/promoter construct was electroporated at E3 into the left side of the spinal cord. At E15, midline-crossing axons are evident in the brachial FP (yellow arrows) and RP (white arrows). Detailed views of three examples in insets; left inset is an enlargement of the boxed area in (C). (D and E) Transverse sections at the sciatic plexus level at E15 (D) and E17 (E). Axons cross only at the FP (white arrows). The GB lacks axonal labeling. (F) Transverse section at the crural plexus level at E17. Right inset is an enlargement of the boxed area in (F). Axons cross at the FP (yellow arrow) and RP (white arrow). (G) Box plot of the ratio between axons crossing the RP and the FP at different axial levels in E15 chick. Numbers of midline-crossing axons were scored at cervical (15 sections), brachial (31 sections), thoracic (27 sections), lumbar crural (23 sections), and lumbar sciatic (14 sections) levels of one embryo. At the sciatic level, axons did not cross the GB (see Supplementary Statistics).

  • Fig. 6 Patterns of pre-MNs in the brachial and lumbar chick spinal cord.

    (A to C) Cell distribution maps in the brachial and lumbar segments of E15 spinal cord sections of chicks in which the hindlimb (A), distal wing (B), or pectoral (C) musculature was injected with PRV-cherry at E14. Data are from 1038 ipre-MNs and 88 cpre-MNs in (A) (three embryos), 620 ipre-MNs and 210 cpre-MNs in (B) (four embryos), and 734 ipre-MNs and 392 cpre-MNs in (C) (two embryos). Ellipses in dashed magenta represent the areas occupied by motoneurons. (A’ to C’) Images of PRV-positive neurons supplemented with immunostaining for motoneurons (ChAT); right insets are enlargements of the midline boxed area showing axonal decussation of pre-MNs at the FP (yellow arrows) and RP (white arrows); white ellipses represent the central canal. (D) Identification of a subpopulation of pre-MNs that innervate pectoral muscle motoneurons bilaterally. PRV-GFP and PRV-cherry were injected bilaterally at E14 into the pectoral muscles. Cell distribution map of bilaterally innervating pectoral pre-MNs seen at E15 is shown in gray. (D’) Examples of bilaterally innervating pre-MNs. Left: Merged images. Middle: PRV-cherry. Right: PRV-GFP. Out of 500 and 730 cpre-MNs on each side (18 sections), 11.9% ± 0.05% and 10.9% ± 0.04% were double-labeled.

  • Fig. 7 Expression of exogenous ephrin-B3 in the chick RP prevents midline crossing.

    (A) Strategy for ectopic expression of the mouse ephrin-B3 at the RP. (B) Cross section from brachial spinal cord of E17 embryo expressing ephrin-B3 (magenta) at the dorsal midline, immunostained for neurofilament (cyan). (C and D) Magnifications of three examples of dorsal midline region of spinal cords electroporated with GFP (C, C’, and C”) or ephrin-B3 (D, D’, and D”) (both in magenta), immunostained for neurofilament (cyan). The black and white images are the neurofilament (3A10) staining. Some neurites cross the GFP-expressing RP (C) but not the ephrin-B3–expressing RP. (E) Quantification of dorsal midline crossing in spinal cords expressing GFP (N = 43 sections, three embryos), mouse ephrin-B3 (N = 71 sections, three embryos), or ephrin-B3-ΔC (N = 59 sections, three embryos). Comparing the number of neurites in the ephrin-B3 and ephrin-b3-ΔC RP to the control (GFP-expressing) RP using Dunnett’s method shows a significant difference between the control group and the experimental groups. The circle charts show the significance of these results. No overlapping between the control group (red circle) and the experimental groups (black circles) is indicative of P < 0.05 (see Supplementary Statistics). Thus, the numbers of neurites crossing ephrin-B3– or ephrin-B3-ΔC–expressing RPs were significantly lower than in GFP-expressing controls (see Supplementary Statistics).

  • Fig. 8 Expression of exogenous ephrin-B3 in the chick RP prevents pre-MN crossing.

    (A) Schematic of the experimental setup. GFP or ephrin-B3 was expressed in the midline at E3. At E14, PRV-cherry was unilaterally injected into the wing musculature, and embryos were fixed and processed 38 hours later. ChAT-immunostained (cyan) MNs and PRV-labeled (magenta) pre-MNs are indicated; dashed line represents cpre-MN axons that cross the RP. (B and C) Transverse sections of control (B) and Wnt1::ephrin-B3–expressing E15 embryos [three examples in (C), (C’), and (C”)]. The black and white images are in (B’), and the insets in (C), (C’), and (C”) are PRV staining. In the control (B), cpre-MN somata are located ventral and dorsal to the central canal, and neurites of cpre-MNs are apparent at the FP [yellow arrow in (B’)] and RP [white arrow in (B’)]. In Wnt1::mEFNB3 embryos (C, C’, and C”), the somata of pre-MNs are mainly located ventral to the central canal. Axons crossing the FP (yellow arrows) and few short neurites (white arrowheads) crossing the dorsal midline are shown in the right insets. (D) Density maps of brachial cpre-MNs in control (GFP, N = 627 cells from three embryos) and five ephrin-B3–expressing embryos (N = 341, 547, 348, 48, and 72 cells). The fraction of sections containing ephrin-B3 expression along the entire dorsal midline is indicated at the top of each spinal cord. A ventral shift of the distribution is apparent in the high-efficiency electroporated spinal cords of Wnt1-B3-4 and Wnt-1-B3-5. (E) Plot demonstrating the correlation between the percentage of dorsal cpre-MNs from all pre-MNs and the electroporation efficiency [as described in (D)]. The average of three GFP-expressing embryos is indicated as a green dot.

  • Fig. 9 Spinal circuits that enable limb alternation, hopping, or flying in mouse and chicken.

    (A and B) Schematic illustration of the morphology and circuit wiring of the spinal cord in WT mouse (A) and in hopB3 mutants. (C and D) Schematic illustration of the morphology and circuit wiring of the avian spinal cord at the lumbar (C) and brachial (D) levels. We propose that dorsal midline crossing is prevented at the lumbar level by the GB but enabled at the brachial level due to the loss of ephrin-B3 activity. The brachial avian spinal cord shares significant morphological and wiring similarities with mouse hopB3 mutants. (E) Schematic illustration of the circuitry at the brachial level of the chick following expression of the mouse ephrin-B3 at the RP. The circuitry resembles that of the WT mouse (A) and the chick lumbar level (C).

  • Table 1 List of primers that were used for generating the RNA probes.
    NameSequence
    cEFNB1-FGAAAAAGGACCAGGCAGATGC
    cEFNB1-R-T7AGCTAATACGACTCACTATAGTTCTCTGTAGTCCGTAAGGG
    cEFNB2-FGAGGGGTGTGCCAGACAAAA
    cEFNB2-R-T7AGCTAATACGACTCACTATAGCACTGTCTGCAGTCCTTAGAG
    cEPHA4-FACAGGCCCAATGGAGTCATC
    cEPHA4-T7AGCTAATACGACTCACTATAGGCATCCAAGGAGCCATTCTC
    mEFNB3-F2CCAGAACAGGAAGTCGCACT
    mEFNB3-T7AGCTAATACGACTCACTATAGCAAGACAAATTGGGCCTGCC
    vGlut2-FGGAAGATGGGAAGCCCATGG
    vGlut2-T7GAAGTCGGCAATTTGTCCCC
    zfEFNB3_3′-F-T3GCAATTAACCCTCACTAAAGGCACGCCCACAAAGGGAAGGA
    zfEFNB3_3′-R-T7AGCTAATACGACTCACTATAGTCTAATCAGCAGCAGCCGCG
    zfEFNB3_5′-F-T3GCAATTAACCCTCACTAAAGGTTACGTGCTGTACCCGCAGAT
    zfEFNB3_5′-R-T7AGCTAATACGACTCACTATAGCTCGTCTGATTGGCTGAACCT

Supplementary Materials

  • Supplementary Materials

    Natural loss of function of ephrin-B3 shapes spinal flight circuitry in birds

    Baruch Haimson, Oren Meir, Reut Sudakevitz-Merzbach, Gerard Elberg, Samantha Friedrich, Peter V. Lovell, Sónia Paixão, R�diger Klein, Claudio V. Mello, Avihu Klar

    Download Supplement

    The PDF file includes:

    • Supplementary Text
    • Figs. S1 to S8
    • Tables S1 and S2
    • Legend for movie S1
    • Supplementary Statistics

    Other Supplementary Material for this manuscript includes the following:

    Files in this Data Supplement:

Stay Connected to Science Advances

Navigate This Article