Table 1 DNA sequences.

emGFP, emerald GFP; CT, control template.

DNA nameDNA sequenceModification
Amino T7GAATXAAXACGACXCACXAXAGGGXCXAGX = C6-amino-dT
mV FRWTTAACTTTAAGAAGGAGGTATACATATGGTGAGCAAGGGCGAGGAGCTGT
mV REVTACTCGAGAATTCCCGGGATCCTCATTACTTGTACAGCTCGTCCATGCCG
CT-FP FRWCGGCATGGACGAGCTGTACAAGTAATGAGGATCCCGGGAATTCTCGAGTA
CT-FP REVACAGCTCCTCGCCCTTGCTCACCATATGTATACCTCCTTCTTAAAGTTAAAC
mC FRWTTAACTTTAAGAAGGAGGTATACATATGGTGAGCAAGGGCGAGGAGGATA
mC REVTACTCGAGAATTCCCGGGATCCTCATTACTTGTACAGCTCGTCCATGCCG
HL FRWTTAACTTTAAGAAGGAGGTATACATATGGCAGATTCTGATATTAATATTA
HL-LINK REVAGAGCCACCTCCGCCTGAACCGCCACCACCCGAATTTGTCATTTCTTCTTTTTCCCAA
HL REVTACTCGAGAATTCCCGGGATCCTCATTAATTTGTCATTTCTTCTTTTTCCCAA
emGFP-LINK FRWTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGTGAGCAAGGGCGAGGAGCTGT
CT-HL FRWTTGGGAAAAAGAAGAAATGACAAATTAATGAGGATCCCGGGAATTCTCGAGTA
CT-HL REVTAATATTAATATCAGAATCTGCCATATGTATACCTCCTTCTTAAAGTTAAAC
CT-emGFP FRWCGGCATGGACGAGCTGTACAAGTAATGAGGATCCCGGGAATTCTCGAGTA
CT-seq FRWGCTAGTGGTGCTAGCCCCGC
CT-seq REVGGGACCGCTAGCGCGGCCGC
Fusion linkerTCGGGTGGTGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG
CT REVGATATAGTTCCTCCTTTCAG