Table 1 Sequence of detection keys designed for the PAD (see table S1 for other targets).

PVL, Panton-Valentine leukocidin.

CategoryTargetDNA sequence (5′ to 3′)
UNIUniversalCAATGTACAGTATTGTGGAGCATGTGGTTTAATTCGA
HAIEscherichiaCAATGTACAGTATTGTGGAGGAAGGGAGTAAAGTTAAT
KlebsiellaCAATGTACAGTATTGTGGAGGCAAGGCGATAAGGT
AcinetobacterCAATGTACAGTATTGTTCTAGTTAATACCTAGGGATAGTG
PseudomonasCAATGTACAGTATTGTGGAGGAAGGGCAGTAAGTTAA
StaphylococcusCAATGTACAGTATTGTGGGAAGAACATATGTGTAAGTAAC
ARVnucCAATGTACAGTATTGTTGCTTCAGGACCATATTTCTCTAC
femBCAATGTACAGTATTGTCCAGAAGCAAGGTTTAGAATTG
mecACAATGTACAGTATTGTCTGCTATCCACCCTCAAACAG
PVLCAATGTACAGTATTGTCGGTAGGTTATTCTTATGGTGGAG