No.Transcript nameForward (5′-3′)Reverse (5′-3′)
1Pou5f1GCTCACCCTGGGCGTTCTCGGCCGCAGCTTACACATGTTC
2Klf4CAGGCTGTGGCAAAACCTATCGTCCCAGTCACAGTGGTAA
3NanogAAGTACCTCAGCCTCCAGCAGTGCTGAGCCCTTCTGAATC
4Sox2AGGGCTGGGAGAAAGAAGAGATCTGGCGGAGAATAGTTGG
5EsrrbGAACACTCTCGCCTGGTAGGCGCCTCCAGGTTCTCAATGT