Table 1 Primer list for the studied genes.

Oligo nameSequence 5′ to 3′
Casp-3 (human) FGAAATTGTGGAATTGATGCGTGA
Casp-3 (human) RCTACAACGATCCCCTCTGAAAAA
MMP-1 (human) FGGGGCTTTGATGTACCCTAGC
MMP-1 (human) RTGTCACACGCTTTTGGGGTTT
Ki-67 (human) FGCTGGCTCCTGTTCACGTA
Ki-67 (human) RCTGGGCTACACTGAGCACC
RPS27A (human) FGCTTGCCAGCAAAGATCAGT
RPS27A (human) RGAGGTTGAACCCTCGGATAC