Table 1 Primers for qRT-PCR.

CADTACGTGTCTCTCGCTCCTTCCTGAGGCACCTTTACTCCCA
CTPS1AGCTTGGCAGAAGCTCTGTACCAACTGCATCCCTAAGCAC
CTPS2AACCGAGGACCCTGTGAAATTCACTGCTAGTTGCATCCCA
GFPT1ACGGGAGACAGATTGTGGAGATCAGGCAGCCGTTTCAATC
GFPT2CTCATCGTGATTGGCTGTGGGCAAACGTCATCCCTGAACA
GMPSCAGAGAGTCAAAGCCTGCACACCCTGCACACCTACAGTTT
NADSYN1CACACGGTTCCCATGTCCTATGTGCAGAGGCCTCCATAAG
PFASCCAGGGAAAGGAAGTCCGATGTGGTTGCACCACTAAAGGG
PPATCGAGAGGAATGTGGCGTGTTCCCACGAGTCCCAGAGTGAT
ASNSTGCTGGCAGGATCAACTAGGGTGTTGTGGTGCATGCCTAT
ASNSDGGGCGGGACTAAAGGAACTAGAAGCAAACCAGACTGCACA
ORF21AATCAAGCACCTCCACAACCGCAAACCGACTGGCAAAAAT
PANCCGCCGATTGTGGGTTGATTTTTTGTTCTGCGGGCTTATGGAG
ORF57TGCTCTTGGCCTTTGTCCTATGCACAAGCTGTGATGTTCC
ORF59CTATGCCAGCGTCGAGTACAGGAAGGCAGTGGAGACGTTA
K8CAAGAGGCGACTACATAGAAAGATCACATACTTCGGCCTTAAC
ORF75TGGAGCTGTTTGTCTCCAAGGTTGAGAAAGTGCTCTGCCA