Table 2 List of plasmids used in this study.

VSVG, vesicular stomatitis virus glycoprotein; aa, amino acid; IRES, internal ribosome entry site.

NameBackboneSpecies and additional
information
Primers or reference
psPAX2Plasmid coding for lentiviral
packaging GagPol
Addgene 12260 from Trono Lab
pMDG2Plasmid coding for VSVG envelopeAddgene 12259 from Trono Lab
pGIPZ nonsilencingPlasmid coding for lentiviral
genome containing shRNA, IRES,
and TurboGFP under hCMV
promoter
Thermo Scientific Open Biosystems
pmRFP-CLCmRFP-C1mRFP–clathrin light chain
peGFP-FCHo2peGFP-C1Mouse full-length FCHo2A gift from H. McMahon, see (16)
pHA-C1peGFP-C1
(Clontech)
Modified backbone with HA tag
used for creating HA-labeled
constructs
Age I–HA:
CCGGTCGCCACCATGGCGTACCCATACGACGTCCCAGACTACGCGCT;
HA–C1–Brs GI:
TAGAGCGCGTAGTCTGGGACGTCGTATGGGTACGCCATGGTGGCGA
pHA-FCHo2 wtpHA-C1Mouse full-length FCHo2 with
HA-tagged backbone
Cloned from peGFP-FCHo2 (16) using Age I/Bsr GI
pHA-FCHo1pHA-C1Full-length mouse FCHo1 in
HA-tagged backbone
Cloned from FCHo1-pmCherryC1 (Addgene 27690)
pHA-FCHo2 F38E
W73E
pHA-C1Mouse FCHo2, dimerization defectCloned from peGFP-FCHo2 F38E W73E (16)
pHA-FCHo2 K146E
K165E
pHA-C1Mouse FCHo2, membrane binding
mutant
Cloned from peGFP-FCHo2 K146E K165E (16)
pHA-FCHo2
FBAR-APA
pHA-C1Mouse FCHo2 aa 1–394 (F-BAR
domain and APA domain)
Forward: CATGGTCCTGCTGGAGTTCGTGAC; reverse:
AATTCTCGAGTCAGTGTCTAGATACTGCTGGGG
pHA-FCHo2 APA μHDpHA-C1Mouse FCHo2 APA and μHD
domains (306–873)
Forward: ATTTGTACAAGGAATGTCCTGACTTAGATTCG; reverse: rev_
eGFP_C
pHA FCHo2 APApHA-C1Mouse FCHo2 aa 306–394 (APA
domain)
Forward: ATTTGTACAAGGAATGTCCTGACTTAGATTCG; reverse:
AATTCTCGAGTCAGTGTCTAGATACTGCTGGG
pHA FCHo2 ΔAPApHA-C1Mouse FCHo2 deletion of aa
306–394 (APA domain)
pHA-FCHo2
FBAR FCHo1
pHA-C1Chimera: mouse FCHo1 aa 1–353,
mouse FCHo2 aa 356–873
Reverse: AATTGGTACCTTTTATTTAACTCATCGACTTTCTGC
pHA-FCHo2
FBAR FBP17
pHA-C1Chimera: human FBP17 aa 1–368,
mouse FCHo2 aa 356–873
Reverse: AATTGGTACCTTTTATTTAACTCATCGACTTTCTGC
pHA-FCHo2
FBAR Pacsin1
pHA-C1Chimera: rat Pacsin1 aa 1–306 + 77
aa linker, mouse FCHo2 aa 356–873
Forward: AATTTGTACACAGATCTCGAGCTCAAGCTTGCCACC; reverse:
AATTGGTACCTCTTGGGGTTGGCGCCACC
pHA-FCHo2
FBAR Pacsin2
pHA-C1Chimera: rat Pacsin2 aa 1–306 + 76
aa linker, mouse FCHo2 aa 356–873
Forward: AATTTGTACAaCGGACTCGGATCCGAATTCATGTC; reverse:
AATTGGTACCTCTTAATGTCCTCCTTCTCACTG
pHA-FCHo2
NBAREndoA1-
pHA-C1Chimera: rat endophilin A1
aa1–256, mouse FCHo2 aa356–873
Forward: AATTTGTACAGATCCATGTCGGTGGC; reverse:
AATTGGTACCTCTGATATTCCCTTCTTGGTTG