Table 2 List of ATAC qPCR primers.

Control region
Gene nameForward (5′-3′)Reverse (5′-3′)
Nlrc5AAGGAACGGAGACAGAAGCGAAAGGAGCAAGACCACCCTG
Alox5apGTACAGGGGCAGGTGTTTCAAAGTCTTCCTTGTGCCCTGG
Ikzf2CCTCAGCTTCCACACCTCTGCTCCTCCTGCATCAGTTCTTGA
Tlr4TTCTTGGGAAACACTTGGTGAATGCTGAGAGGAAGATTCGCTT
Ism1GTACAACGCTGGGAGAGTTCCATCTGAGCCCAACCTGGATGA
Mmp13AAGCTGGCTCAGTCCTGTTTTGTAGGGGCAGAGGAAGGGA
Angptl7AGGAGGCTAGTCCGATAGGGAAACCGCAGTACCAGTGCAA
Tgfb2GCAACTGCCATTTTCCTGGGCGGATGGGACAGCCATCCTT
Tnfrsf19CCAATCTTCAGGGCAGGGTTAGAACTGTTGCCAACCCACT
Peak region
Art3TCCCAGGGAAACCTCAAAGGGCTTTCACCTTCCAGTGGCT
Nlrc5GGTTGGGGGTGGGGGTATATGTGAATTATCTAAGGACATGGGC
Alox5apTAGACTCAGGCCAAACCCCTGCCAGTGTGCTATCAAGCCT
Ikzf2TTCCTGACTAGCCCCATCCACAGGACCTGGGTTTTAGCCT
Tlr4ACTCAGACCTGATCCTGCTTGAATGTCAGCCTTCTCCCCAA
Ism1TTCTGGGTGTGGGTGGTCTAGGGAACTGAAGCCTTCTGCC
Mmp13GAGGAGGCATGGGTATGGTCAGAAAGCAGTTGGTTGGCCC
Angptl7GGGAGCCTCCAATTTCTTCCTGCCATTGATGGGATTGTGTTTTTGT
Tgfb2AGAGTATGGCTGGCTCTCCATGGGTCACAATGAGATGGGC
Tnfrsf19AAACGAATGTTGCTGCACGATGTGCGACAGATTGACCCTG