Table 1 List of qPCR primers for mouse.

Gene nameForward (5′-3′)Reverse (5′-3′)
Nrp1CATCTCCCGGTTACCCTCATTCTTGCGGCCGCCTTCATTCTC
VegfaTGGGCTCTTCTCGCTCCGTAGTAGGCCGCCTCACCCGTCCAT
Fosl1CAAGTGGTTCAGCCCAAGAACACAAGGTGGAACTTCTGCTG
Flt1AAAGGCTGAGCATCACTCCCCTACAGGTGTAGAGGCCCGT
Flk1TGTGCTTCTTGTCTCTGGCGCCTTCAAAAGCCTTGACCTCG
Art3CTGGGAGCGCAGTTCTAATGGCAGGTATTCGTCGTCAAACGC
Nlrc5AACCAATGTCTGTGCCCTGTCTGGCTGCTCAGAAGTGGTA
Alox5apCTCATTTTGCGGTCGCTATCCATCCATGCCATTGTAGCCGTA
Ikzf2GAGCCGTGAGGATGAGATCAGCTCCCTCGCCTTGAAGGTC
Tlr4TCGACATGGATCAGTTTATGCGCCCTGGTACTGTTGTAGATGGA
Ism1AGAGCAGCCAGAGTATGATTCCGCCGCTGTCCTGAAAGTATCT
Mmp13CTTCTTCTTGTTGAGCTGGACTCCTGTGGAGGTCACTGTAGACT
Angptl7AGAGGCCCCAGCTTATTCCAACAGGGGTATAGCTTCCAAGGC
Tgfb2TCGACATGGATCAGTTTATGCGCCCTGGTACTGTTGTAGATGGA
Tnfrsf19TTCTGTGGGGGACACGATGAGAAAATTCAGCGCAGATGGAA
B actinCCAGCCTTCCTTCTTGGGTATTGTTGGCATAGAGGTCTTTACGG