Table 4 Primers used for deep sequencing.

Amplified
region
F/RSequence (5′ to 3′)
HBG
promoters
FGGAATGACTGAATCGGAACAAGG
RCTGGCCTCACTGGATACTCT
OT −197.1FGTGGGTTATAGAAAGGGCAAGCTG
RCCTTCCACTCAGATCTTGCCC
OT −197.2FCATCTAAGAGATTGGCAAAAATTATAGAGTCCCAAC
RGTAATGTGATTGCTGGGTTGAGCC
OT −197.3FCTTCTCAAAAGAGCTAGGTGGCTG
RGGGCCAGTACTTCCCTCTTTTTAG
OT −197.4FGATAGCACTGGCAACCTGTTTCTG
RCTTCACTGTTTTGAGCCTCAGTTTCATTCC
OT −197.5FCCTCTTCTCTCCTCCCCTAAC
RCCTGCTGTGTTCTAGGCTCTAAG
OT −196.1FGTGGGTTATAGAAAGGGCAAGCTG
RCCTTCCACTCAGATCTTGCCC
OT −196.2FGCCGGGTTAAGGGCGTAGAA
RCCCCTCAAACCCACTCTTAAAACC
OT −196.3FATCACTTAAACAAGGATGCTCACCTCAGGTTC
RCGGTCCAACCTGGAAATCTCTG
OT −196.4FCCCCTTTCATTTACTAACCAGGCATACC
RGAGGGGCTTTTACTGGGCAATTG
OT −196.6FGTTATGGACTGTAGCAGGACAAGC
RGTTGTGAGCCCTTAAAAGGCACAG
OT −195.1FACAAACCATTGTGTGGGACTTTGGAGAC
RCTATGCCATGTACTCTCCCTGAC
OT −195.2FCATGCCATGAAGGAAAATAAAGCAAGGTAAGAAG
RCTAATACATTTCCTTACTTCATTCACGTCACTGC
OT −115.1FATTGGGGGAGACAGACCCATG
RCATTTTTATCCAGCTTGGCAGGGG