Table 3 Primers used for digital droplet PCR.

Amplified regionF/RSequence (5′ to 3′)
HBG1-HBG2
intervening region
FGTTTTAAAACAACAAAAATGAGGGAAAGA
RGTTGCTTTATAGGATTTTTCACTACAC
Chr11 control regionFCCCTTCCGAGAGGATTTAGG
RAGTCGGGATCTGAACAATGG