Table 5 Primer sequences used for RT-qPCR.

Amplified regionF/RSequence (5′ to 3′)
HBAFCGGTCAACTTCAAGCTCCTAA
RACAGAAGCCAGGAACTTGTC
HBBFGCAAGGTGAACGTGGATGAAGT
RTAACAGCATCAGGAGTGGACAGA
HBG1 + HBG2FCCTGTCCTCTGCCTCTGCC
RGGATTGCCAAAACGGTCAC
HBDFCAAGGGCACTTTTTCTCAG
RAATTCCTTGCCAAAGTTGC
HBEFCTTTGGAAACCTGTCGTC
RCTTGCCAAAGTGAGTAGC
GATA1FGACAGGACAGGCCACTACCTATG
RAGTACCTGCCCGTTTACTGACAA
ALAS2FCAGCGCAATGTCAAGCAC
RTAGATGCCATGCTTGGAGAG
BAND3FACCTCTCTCACCTCACCTTCTG
RAACCTGTCTAGCAGTTGGTTGG
GAPDHFGAAGGTGAAGGTCGGAGT
RGAAGATGGTGATGGGATTTC