Table 2 Primer used to detect InDel events.

F, forward primer; R, reverse primer.

Amplified regionF/RSequence (5′ to 3′)
HBG1 + HBG2
promoters
FAAAAACGGCTGACAAAAGAAGTCCTGGTAT
RATAACCTCAGACGTTCCAGAAGCGAGTGTG
HBG1 promoterFTACTGCGCTGAAACTGTGGC
RGGCGTCTGGACTAGGAGCTTATTG
HBG2 promoterFGCACTGAAACTGTTGCTTTATAGGAT
RGGCGTCTGGACTAGGAGCTTATTG
AAVS1FCAGCACCAGGATCAGTGAAA
RCTATGTCCACTTCAGGACAGCA