Table 1 The gene-specific primers used in qRT-PCR.

Sequence (5′→3′)
MSNForward: ATCACTCAGCGCCTGTTCTTReverse: CCCACTGGTCCTTGTTGAGT
TBPForward: CACGAACCACGGCACTGATTReverse: TTTTCTTGCTGCCAGTCTGGAC
ALS2Forward: AGATGGTGAGGTCTACAGCTTReverse: GAATGGGGCTACTTGGACAAAT
CCNA1Forward: GAGGTCCCGATGCTTGTCAGReverse: GTTAGCAGCCCTAGCACTGTC
NONOForward: GGCAGGCGAAGTCTTCATTCAReverse: TGGCAATCTCCGCTAGGGT
CREBForward: ATTCACAGGAGTCAGTGGATAGTReverse: CACCGTTACAGTGGTGATGG