Table 2 The sense sequence of shRNAs.

Sequence (5′→3′)
MSNsh-1CCGGGCTAAATTGAAACCTGGAATTCTCGAGAATTCCAGGTTTCAATTTAGCTTTTTG
sh-4CCGGGCATTGACGAATTTGAGTCTACTCGAGTAGACTCAAATTCGTCAATGCTTTTTG
NONOsh-1CCGGGCCAGAATTCTACCCTGGAAACTCGAGTTTCCAGGGTAGAATTCTGGCTTTTTG
sh-3CCGGGCAGGCGAAGTCTTCATTCATCTCGAGATGAATGAAGACTTCGCCTGCTTTTTG
sh-5CCGGCAGGCGAAGTCTTCATTCATACTCGAGTATGAATGAAGACTTCGCCTGTTTTTG
CREBsh-1CCGGGCTCGATAAATCTAACAGTTACTCGAGTAACTGTTAGATTTATCGAGCTTTTT
sh-4CCGGCAGTGGATAGTGTAACTGATTCTCGAGAATCAGTTACACTATCCACTGTTTTT
PRKCZsh-1CCGGCAAGCTCACAGACTACGGCATCTCGAGATGCCGTAGTCTGTGAGCTTGTTTTT
sh-3CCGGACCTAATCAGAGTCATCGGGCCTCGAGGCCCGATGACTCTGATTAGGTTTTTT