Table 1 Primer list.

F, forward; R, reverse.

Primer nameSequence
ChIP qPCR primers
FruM(−488)-ChIP FCAGGAGCTGTTACCATTTCAC
FruM(−488)-ChIP RCCTTTACAGTGCCCGTTTAC
FruM(+37)-ChIP FAAATCAGCAGCCGACATAC
FruM(+37)-ChIP RTTTACAGCGCTCTAGCATTT
FruM(+1224)-ChIP FAGTTGGCTGAGCACAATTC
FruM(+1224)-ChIP RACACGGATTAGCCAGTTT
Or82a(+109)-ChIP FGCTCTGACGTTGGCATAAC
Or82a(+109)-ChIP RGCAGTTGAAACAGCCTACC
Gr5a(−109)-ChIP FAATGCGACAGCTGAAAGG
Gr5a(−109)-ChIP RTCATGGGATTCTAACGATTTGG
Or47b(+147)-ChIP FCTTTCTGAGGTGAATCTG
Or47b(+147)-Chip RCTTCTTGTTGGGATACTG
Kr-h1-ChIP F (+10)CGTGACGTTCTCCGAATTT
Kr-h1-ChIP R (+135)ACGAGATCGATTGGTAGGT
E-box-ChIP F (−7774)GACGCATAAACGTCTTCCA
E-box-ChIP R (−7641)CTCAGCTGCATCTCATTCTC
qRT-PCR primers
Or47b_qPCR FCAAATCTCAGCCTTCTGCGG
Or47b_qPCR RGATACTGGCACAGCAAACTCA
Gal4_qPCR FTTATGCCCAGGGATGCTCTT
Gal4_qPCR RCGTCGCCAAAGAACCCATTA
GFP_qPCR FATGGAAGCGTTCAATTAGCAGA
GFP_qPCR RAAAGGGCAGATTGTGTGGAC
fruC_qPCR FCAAATTTGACCGGCGTGCTAACCT
fruC_qPCR RAGTCGGAGCGGTAGTTCAGATTGT
fruM_qPCR FCCCGCATCCCCTAGGTACAA
fruM_qPCR RGACTGTTTCGCCCTCGCAGG
ACT5C_qPCR FGGCGCAGAGCAAGCGTGGTA
ACT5C_qPCR RGGGTGCCACACGCAGCTCAT
RPL13A_qPCR FGCGAGGAGCTGAACCTCTC
RPL13A_qPCR RGGAAGTGGAATGGACCACGG
RpLP0_qPCR FGTGCCCATCCTGAAGCCTG
RpLP0_qPCR RCCTGGTTGACAATCAGACCGT
TBP_qPCR FTAAGCCCCAACTTCTCGATTCC
TBP_qPCR RGCCAAAGAGACCTGATCCCC