Table 1 Primers for quantitative reverse transcription polymerase chain reaction detection of expression genes in C. pyrenoidosa.

Primers for quantitative reverse transcription polymerase chain reaction detection of expression genes in C. pyrenoidosa..

GenePrimer sequence (5′→3′)Length of
production
prkAGGAGAAGGCGGTGACTG116
GACGTGGTTGTAGATGGG
rbcLAAACTGGTGAAATTAAAGGGC195
CACGGTGAATGTGTAAAAGAA
β-ActinTTTGACTCAACACGGGAAAAC115
CAACCCACCAACTAAGAACGG