Table 1 List of primers.

GeneForward primerReverse primer
RUNX2GGTCAGATGCAGGCGGCCCTACGTGTGGTAGCGCGTGGC
OSXGGCAAAGCAGGCACAAAGAAAGAATGAGTGGGAAAAGGGAGGG
OCNCAGCGAGGTAGTGAAGAGACCTCTGGAGTTTATTTGGGAGCAG
OPNAGCTGGATGACCAGAGTGCTTGAAATTCATGGCTGTGGAA
OSNAGAATGAGAAGCGCCTGGAGCTGCCAGTGTACAGGGAAGA
ALPATGAAGGAAAAGCCAAGCAGCCACCAAATGTGAAGACGTG
PPARGGACAGGAAAGACAACAGACAAATCGGGGTGATGTGTTTGAACTTG
FABP4CCTTTAAAAATACTGAGATTTCCTTCAGGACACCCCCATCTAAGGTT
GLUT4CTGTCCACCAAGCCCTCTCCATCCCCAGTCTCCACTGTT
SOX9GCTCTGGAGACTTCTGAAGGTACTTGTAATCCGGGTG
COL2A1GGCTTCCATTTCAGCTATGCAGTGGTAGGTGATGTTC
ACANGGCTTCCACCAGTGTGACGTGTCTCGGATGCCATACG
GAPDHTCAAGGCTGAGAACGGGAATGGGTGGCAGTGATGGCA