Table 1 List of primers that were used for generating the RNA probes.
NameSequence
cEFNB1-FGAAAAAGGACCAGGCAGATGC
cEFNB1-R-T7AGCTAATACGACTCACTATAGTTCTCTGTAGTCCGTAAGGG
cEFNB2-FGAGGGGTGTGCCAGACAAAA
cEFNB2-R-T7AGCTAATACGACTCACTATAGCACTGTCTGCAGTCCTTAGAG
cEPHA4-FACAGGCCCAATGGAGTCATC
cEPHA4-T7AGCTAATACGACTCACTATAGGCATCCAAGGAGCCATTCTC
mEFNB3-F2CCAGAACAGGAAGTCGCACT
mEFNB3-T7AGCTAATACGACTCACTATAGCAAGACAAATTGGGCCTGCC
vGlut2-FGGAAGATGGGAAGCCCATGG
vGlut2-T7GAAGTCGGCAATTTGTCCCC
zfEFNB3_3′-F-T3GCAATTAACCCTCACTAAAGGCACGCCCACAAAGGGAAGGA
zfEFNB3_3′-R-T7AGCTAATACGACTCACTATAGTCTAATCAGCAGCAGCCGCG
zfEFNB3_5′-F-T3GCAATTAACCCTCACTAAAGGTTACGTGCTGTACCCGCAGAT
zfEFNB3_5′-R-T7AGCTAATACGACTCACTATAGCTCGTCTGATTGGCTGAACCT